Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene
PTXBC040857
New product
Data sheet of SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC040857 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINA12 |
| Origin species: | Human |
| Product name: | SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene |
| Size: | 2ug |
| Accessions: | BC040857 |
| Gene id: | 145264 |
| Gene description: | serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 |
| Synonyms: | OL-64; serpin A12; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12; serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12; vaspin; visceral adipose tissue-derived serine protease inhibitor; visceral adipose-specific SERPIN; serpin family A member 12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaccccacactaggcctggccatttttctggctgttctcctcacggtgaaaggtcttctaaagccgagcttctcaccaaggaattataaagctttgagcgaggtccaaggatggaagcaaaggatggcagccaaggagcttgcaaggcagaacatggacttaggctttaagctgctcaagaagctggccttttacaaccctggcaggaacatcttcctatcccccttgagcatctctacagctttctccatgctgtgcctgggtgcccaggacagcaccctggacgagatcaagcaggggttcaacttcagaaagatgccagaaaaagatcttcatgagggcttccattacatcatccacgagctgacccagaagacccaggacctcaaactgagcattgggaacacgctgttcattgaccagaggctgcagccacagcgtaagtttttggaagatgccaagaacttttacagtgccgaaaccatccttaccaactttcagaatttggaaatggctcagaagcagatcaatgactttatcagtcaaaaaacccatgggaaaattaacaacctgatcgagaatatagaccccggcactgtgatgcttcttgcaaattatattttctttcgagccaggtggaaacatgagtttgatccaaatgtaactaaagaggaagatttctttctggagaaaaacagttcagtcaaggtgcccatgatgttccgtagtggcatataccaagttggctatgacgataagctctcttgcaccatcctggaaataccctaccagaaaaatatcacagccatcttcatccttcctgatgagggcaagctgaagcacttggagaagggattgcaggtggacactttctccagatggaaaacattactgtcacgcagggtcgtagacgtgtctgtacccagactccacatgacgggcaccttcgacctgaagaagactctctcctacataggtgtctccaaaatctttgaggaacatggtgatctcaccaagatcgcccctcatcgcagcctgaaagtgggcgaggctgtgcacaaggctgagctgaagatggatgagaggggtacggaaggggccgctggcaccggagcacagactctgcccatggagacaccactcgtcgtcaagatagacaaaccctatctgctgctgatttacagcgagaaaataccttccgtgctcttcctgggaaagattgttaaccctattggaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 - guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 - mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B - DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) |