SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene View larger

SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040857
Product type: DNA & cDNA
Ncbi symbol: SERPINA12
Origin species: Human
Product name: SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene
Size: 2ug
Accessions: BC040857
Gene id: 145264
Gene description: serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12
Synonyms: OL-64; serpin A12; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12; serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12; vaspin; visceral adipose tissue-derived serine protease inhibitor; visceral adipose-specific SERPIN; serpin family A member 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccccacactaggcctggccatttttctggctgttctcctcacggtgaaaggtcttctaaagccgagcttctcaccaaggaattataaagctttgagcgaggtccaaggatggaagcaaaggatggcagccaaggagcttgcaaggcagaacatggacttaggctttaagctgctcaagaagctggccttttacaaccctggcaggaacatcttcctatcccccttgagcatctctacagctttctccatgctgtgcctgggtgcccaggacagcaccctggacgagatcaagcaggggttcaacttcagaaagatgccagaaaaagatcttcatgagggcttccattacatcatccacgagctgacccagaagacccaggacctcaaactgagcattgggaacacgctgttcattgaccagaggctgcagccacagcgtaagtttttggaagatgccaagaacttttacagtgccgaaaccatccttaccaactttcagaatttggaaatggctcagaagcagatcaatgactttatcagtcaaaaaacccatgggaaaattaacaacctgatcgagaatatagaccccggcactgtgatgcttcttgcaaattatattttctttcgagccaggtggaaacatgagtttgatccaaatgtaactaaagaggaagatttctttctggagaaaaacagttcagtcaaggtgcccatgatgttccgtagtggcatataccaagttggctatgacgataagctctcttgcaccatcctggaaataccctaccagaaaaatatcacagccatcttcatccttcctgatgagggcaagctgaagcacttggagaagggattgcaggtggacactttctccagatggaaaacattactgtcacgcagggtcgtagacgtgtctgtacccagactccacatgacgggcaccttcgacctgaagaagactctctcctacataggtgtctccaaaatctttgaggaacatggtgatctcaccaagatcgcccctcatcgcagcctgaaagtgggcgaggctgtgcacaaggctgagctgaagatggatgagaggggtacggaaggggccgctggcaccggagcacagactctgcccatggagacaccactcgtcgtcaagatagacaaaccctatctgctgctgatttacagcgagaaaataccttccgtgctcttcctgggaaagattgttaaccctattggaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
- guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
- mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
- DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)

Buy SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene now

Add to cart