Login to display prices
Login to display prices
SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene View larger

SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene

PTXBC040857

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene

Proteogenix catalog: PTXBC040857
Ncbi symbol: SERPINA12
Product name: SERPINA12-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 Gene
Size: 2ug
Accessions: BC040857
Gene id: 145264
Gene description: serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12
Synonyms: OL-64; serpin A12; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12; serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12; vaspin; visceral adipose tissue-derived serine protease inhibitor; visceral adipose-specific SERPIN; serpin family A member 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccccacactaggcctggccatttttctggctgttctcctcacggtgaaaggtcttctaaagccgagcttctcaccaaggaattataaagctttgagcgaggtccaaggatggaagcaaaggatggcagccaaggagcttgcaaggcagaacatggacttaggctttaagctgctcaagaagctggccttttacaaccctggcaggaacatcttcctatcccccttgagcatctctacagctttctccatgctgtgcctgggtgcccaggacagcaccctggacgagatcaagcaggggttcaacttcagaaagatgccagaaaaagatcttcatgagggcttccattacatcatccacgagctgacccagaagacccaggacctcaaactgagcattgggaacacgctgttcattgaccagaggctgcagccacagcgtaagtttttggaagatgccaagaacttttacagtgccgaaaccatccttaccaactttcagaatttggaaatggctcagaagcagatcaatgactttatcagtcaaaaaacccatgggaaaattaacaacctgatcgagaatatagaccccggcactgtgatgcttcttgcaaattatattttctttcgagccaggtggaaacatgagtttgatccaaatgtaactaaagaggaagatttctttctggagaaaaacagttcagtcaaggtgcccatgatgttccgtagtggcatataccaagttggctatgacgataagctctcttgcaccatcctggaaataccctaccagaaaaatatcacagccatcttcatccttcctgatgagggcaagctgaagcacttggagaagggattgcaggtggacactttctccagatggaaaacattactgtcacgcagggtcgtagacgtgtctgtacccagactccacatgacgggcaccttcgacctgaagaagactctctcctacataggtgtctccaaaatctttgaggaacatggtgatctcaccaagatcgcccctcatcgcagcctgaaagtgggcgaggctgtgcacaaggctgagctgaagatggatgagaggggtacggaaggggccgctggcaccggagcacagactctgcccatggagacaccactcgtcgtcaagatagacaaaccctatctgctgctgatttacagcgagaaaataccttccgtgctcttcctgggaaagattgttaaccctattggaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: