LOC202051-hypothetical protein LOC202051 Gene View larger

LOC202051-hypothetical protein LOC202051 Gene

PTXBC050563

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC202051-hypothetical protein LOC202051 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC202051-hypothetical protein LOC202051 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050563
Product type: DNA & cDNA
Ncbi symbol: LOC202051
Origin species: Human
Product name: LOC202051-hypothetical protein LOC202051 Gene
Size: 2ug
Accessions: BC050563
Gene id: 202051
Gene description: hypothetical protein LOC202051
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgacgcccctcgggtggtcgaaggcggggtcaggatctgtgtgtctcgctttagatcaactgcgggacgtgattgagtctcaggaggaactaatccaccagctgaggaacgtgatggttctccaggacgaaaattttgtcagtaaagaagagttccaggcagtggagaagaagctggtggaagagaaagctgcccatgccaaaaccaaggtcctcctggccaaggaagaggagaagttacagtttgccctcggagaggtagaggtgctatccaagcagctggagaaagagaagctggcctttgaaaaagcgctctccagtgtcaagagcaaagtccttcaggagtccagcaagaaggaccagctcatcaccaagtgcaatggtaggcgggaggcccgtgctctccaccacggttatataaacgggctctttcctaaccacccagtgcctgtgtcaaaggcagggtttcactctaacacctgtccccagctgaggatacaggcaggcccgggtgggccacaccttcgaaaaggccttaagggaccaggcaggccacggaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methyl-CpG binding domain protein 3
- THO complex 6 homolog (Drosophila)
- RELT tumor necrosis factor receptor
- leucine rich repeat containing 28

Buy LOC202051-hypothetical protein LOC202051 Gene now

Add to cart