Login to display prices
Login to display prices
LOC202051-hypothetical protein LOC202051 Gene View larger

LOC202051-hypothetical protein LOC202051 Gene

PTXBC050563

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC202051-hypothetical protein LOC202051 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC202051-hypothetical protein LOC202051 Gene

Proteogenix catalog: PTXBC050563
Ncbi symbol: LOC202051
Product name: LOC202051-hypothetical protein LOC202051 Gene
Size: 2ug
Accessions: BC050563
Gene id: 202051
Gene description: hypothetical protein LOC202051
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgacgcccctcgggtggtcgaaggcggggtcaggatctgtgtgtctcgctttagatcaactgcgggacgtgattgagtctcaggaggaactaatccaccagctgaggaacgtgatggttctccaggacgaaaattttgtcagtaaagaagagttccaggcagtggagaagaagctggtggaagagaaagctgcccatgccaaaaccaaggtcctcctggccaaggaagaggagaagttacagtttgccctcggagaggtagaggtgctatccaagcagctggagaaagagaagctggcctttgaaaaagcgctctccagtgtcaagagcaaagtccttcaggagtccagcaagaaggaccagctcatcaccaagtgcaatggtaggcgggaggcccgtgctctccaccacggttatataaacgggctctttcctaaccacccagtgcctgtgtcaaaggcagggtttcactctaacacctgtccccagctgaggatacaggcaggcccgggtgggccacaccttcgaaaaggccttaagggaccaggcaggccacggaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: