LRRC28-leucine rich repeat containing 28 Gene View larger

LRRC28-leucine rich repeat containing 28 Gene

PTXBC047306

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRRC28-leucine rich repeat containing 28 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LRRC28-leucine rich repeat containing 28 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047306
Product type: DNA & cDNA
Ncbi symbol: LRRC28
Origin species: Human
Product name: LRRC28-leucine rich repeat containing 28 Gene
Size: 2ug
Accessions: BC047306
Gene id: 123355
Gene description: leucine rich repeat containing 28
Synonyms: leucine-rich repeat-containing protein 28; leucine rich repeat containing 28
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtccgaactttgtaagacgatctctgtggcaaggctagaaaagcacaagaatttgttcttaaattataggaatctgcaccattttccattggagttactgaaagatgagggactgcagtacttggagagactctatatgaaaaggaactccctgacatccttgccagaaaaccttgctcagaagcttccaaaccttgtggaactatacctgcactcaaataacatagttgtggttccggaagccattgggtctcttgtaaaactccaatgtctggatcttagtgacaatgccttagaaattgtttgcccagaaattggtcgtctgagagctttacgtcatcttcgattagctaataaccaactgcaattcctacctccagaggttggcgatttgaaggagctgcagacactagacatttctaccaatcgtttgctaactttacccgagaggcttcacatgtgcctttctctgcagtacctcactgtggaccgaaatcgtctatggtatgtgccgcgccatctctgccagctgcccagcctcaatgagctctccatggctggaaaccgtcttgcatttttgccacttgatttaggtcgatctcgagaactacagtatgtatacgtggataacaacattcacctgaaaggcttgccatcttatctgtacaataaagtcatcgggtgcagtggctgtggtgctcccattcaagtttccgaggtgaagctgctttccttttcatcagggcagcgaaccgttttcctcccagctgaggtgaaggccatagggacggagcatgatcacgtcctccctctgcaggaattggctatgagagggctgtatcatacctaccacagcttgctgaaagatttgaactttctgtctccaatctcattacccagaagtctcctagagctgctgcactgccctctggggcactgtcatcggtgtagtgagcctatgtttaccatcgtctaccccaagctctttcccttgagagagacgccaatggcagggctgcaccagtggaagacaactgttagttttgtggcttactgctgctccacccagtgtctgcagacttttgacctgctgagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein LOC339047
- glutaminyl-peptide cyclotransferase
- chromosome 1 open reading frame 2
- transmembrane protease, serine 2

Buy LRRC28-leucine rich repeat containing 28 Gene now

Add to cart