MBD3-methyl-CpG binding domain protein 3 Gene View larger

MBD3-methyl-CpG binding domain protein 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MBD3-methyl-CpG binding domain protein 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MBD3-methyl-CpG binding domain protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC043619
Product type: DNA & cDNA
Ncbi symbol: MBD3
Origin species: Human
Product name: MBD3-methyl-CpG binding domain protein 3 Gene
Size: 2ug
Accessions: BC043619
Gene id: 53615
Gene description: methyl-CpG binding domain protein 3
Synonyms: methyl-CpG-binding domain protein 3; methyl-CpG binding domain protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcggaagagcccgagcgggaagaagttccgcagcaagccgcagctggcgcgctacctgggcggctccatggacctgagcaccttcgacttccgcacgggcaagatgctgatgagcaagatgaacaagagccgccagcgcgtgcgctacgactcctccaaccaggtcaagggcaagcccgacctgaacacggcgctgcccgtgcgccagacggcgtccatcttcaagcagccggtgaccaagattaccaaccaccccagcaacaaggtcaagagcgacccgcagaaggcggtggaccagccgcgccagctcttctgggagaagaagctgagcggcctgaacgccttcgacattgctgaggagctggtcaagaccatggacctccccaagggcctgcagggggtgggacctggctgcacggatgagacgctgctgtcggccatcgccagcgccctgcacactagcaccatgcccatcacgggacagctctcggccgccgtggagaagaaccccggcgtatggctcaacaccacgcagcccctgtgcaaagccttcatggtgaccgacgaggacatcaggaagcaggaagagctggtgcagcaggtgcggaagcggctggaggaggcgctgatggccgacatgctggcgcacgtggaggagctggcccgtgacggggaggcgccgctggacaaggcctgcgctgaggacgacgacgaggaagacgaggaggaggaggaggaggagcccgacccggacccggagatggagcacgtctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - THO complex 6 homolog (Drosophila)
- RELT tumor necrosis factor receptor
- leucine rich repeat containing 28
- hypothetical protein LOC339047

Buy MBD3-methyl-CpG binding domain protein 3 Gene now

Add to cart