Login to display prices
Login to display prices
MBD3-methyl-CpG binding domain protein 3 Gene View larger

MBD3-methyl-CpG binding domain protein 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MBD3-methyl-CpG binding domain protein 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MBD3-methyl-CpG binding domain protein 3 Gene

Proteogenix catalog: PTXBC043619
Ncbi symbol: MBD3
Product name: MBD3-methyl-CpG binding domain protein 3 Gene
Size: 2ug
Accessions: BC043619
Gene id: 53615
Gene description: methyl-CpG binding domain protein 3
Synonyms: methyl-CpG-binding domain protein 3; methyl-CpG binding domain protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcggaagagcccgagcgggaagaagttccgcagcaagccgcagctggcgcgctacctgggcggctccatggacctgagcaccttcgacttccgcacgggcaagatgctgatgagcaagatgaacaagagccgccagcgcgtgcgctacgactcctccaaccaggtcaagggcaagcccgacctgaacacggcgctgcccgtgcgccagacggcgtccatcttcaagcagccggtgaccaagattaccaaccaccccagcaacaaggtcaagagcgacccgcagaaggcggtggaccagccgcgccagctcttctgggagaagaagctgagcggcctgaacgccttcgacattgctgaggagctggtcaagaccatggacctccccaagggcctgcagggggtgggacctggctgcacggatgagacgctgctgtcggccatcgccagcgccctgcacactagcaccatgcccatcacgggacagctctcggccgccgtggagaagaaccccggcgtatggctcaacaccacgcagcccctgtgcaaagccttcatggtgaccgacgaggacatcaggaagcaggaagagctggtgcagcaggtgcggaagcggctggaggaggcgctgatggccgacatgctggcgcacgtggaggagctggcccgtgacggggaggcgccgctggacaaggcctgcgctgaggacgacgacgaggaagacgaggaggaggaggaggaggagcccgacccggacccggagatggagcacgtctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: