Login to display prices
Login to display prices
LRTM1-leucine-rich repeats and transmembrane domains 1 Gene View larger

LRTM1-leucine-rich repeats and transmembrane domains 1 Gene

PTXBC040732

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRTM1-leucine-rich repeats and transmembrane domains 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LRTM1-leucine-rich repeats and transmembrane domains 1 Gene

Proteogenix catalog: PTXBC040732
Ncbi symbol: LRTM1
Product name: LRTM1-leucine-rich repeats and transmembrane domains 1 Gene
Size: 2ug
Accessions: BC040732
Gene id: 57408
Gene description: leucine-rich repeats and transmembrane domains 1
Synonyms: HT017; leucine-rich repeat and transmembrane domain-containing protein 1; leucine rich repeats and transmembrane domains 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccttaaacttgtccaacaattccctttcaaatctggcccctggagctttccatgggcttcagcacttgcaggttttaaatctaacccagaattcactcctttccctggaaagcagacttttccattccctccctcagctgagggagcttgatttgtcatcaaacaacataagccaccttcccacatccttgggagagacttgggagaacctaactatacttgcggttcaacaaaaccagcttcagcagcttgatcgagcgctcctggaatccatgcccagtgtgaggcttttacttctcaaggacaacctctggaaatgcaattgccacttgctcggtcttaaactctggctggagaaatttgtctataaagggggactaacagacggcatcatctgtgaatcaccagacacctggaagggaaaggacctccttaggatccctcatgagctgtaccagccctgccctcttcctgctcctgatccagtgtcctcgcaggctcagtggcccggctctgcccacggtgtggtcctgaggcctcctgagaaccacaacgcgggggagcgagaactcttggagtgcgagctcaaacccaagccaaggccggccaacctgcgtcatgccattgccactgtcatcatcactggcgttgtgtgtgggattgtgtgtctcatgatgttggcagctgccatctatggctgcacctatgcggcaatcacagcccagtaccatgggggacccttggctcaaaccaatgatcctgggaaggtggaagaaaaagagcgatttgacagctcaccagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: