LRTM1-leucine-rich repeats and transmembrane domains 1 Gene View larger

LRTM1-leucine-rich repeats and transmembrane domains 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRTM1-leucine-rich repeats and transmembrane domains 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LRTM1-leucine-rich repeats and transmembrane domains 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040732
Product type: DNA & cDNA
Ncbi symbol: LRTM1
Origin species: Human
Product name: LRTM1-leucine-rich repeats and transmembrane domains 1 Gene
Size: 2ug
Accessions: BC040732
Gene id: 57408
Gene description: leucine-rich repeats and transmembrane domains 1
Synonyms: HT017; leucine-rich repeat and transmembrane domain-containing protein 1; leucine rich repeats and transmembrane domains 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccttaaacttgtccaacaattccctttcaaatctggcccctggagctttccatgggcttcagcacttgcaggttttaaatctaacccagaattcactcctttccctggaaagcagacttttccattccctccctcagctgagggagcttgatttgtcatcaaacaacataagccaccttcccacatccttgggagagacttgggagaacctaactatacttgcggttcaacaaaaccagcttcagcagcttgatcgagcgctcctggaatccatgcccagtgtgaggcttttacttctcaaggacaacctctggaaatgcaattgccacttgctcggtcttaaactctggctggagaaatttgtctataaagggggactaacagacggcatcatctgtgaatcaccagacacctggaagggaaaggacctccttaggatccctcatgagctgtaccagccctgccctcttcctgctcctgatccagtgtcctcgcaggctcagtggcccggctctgcccacggtgtggtcctgaggcctcctgagaaccacaacgcgggggagcgagaactcttggagtgcgagctcaaacccaagccaaggccggccaacctgcgtcatgccattgccactgtcatcatcactggcgttgtgtgtgggattgtgtgtctcatgatgttggcagctgccatctatggctgcacctatgcggcaatcacagcccagtaccatgggggacccttggctcaaaccaatgatcctgggaaggtggaagaaaaagagcgatttgacagctcaccagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - succinate-CoA ligase, GDP-forming, beta subunit
- fragile X mental retardation, autosomal homolog 2
- general transcription factor IIH, polypeptide 5
- zeta-chain (TCR) associated protein kinase 70kDa

Buy LRTM1-leucine-rich repeats and transmembrane domains 1 Gene now

Add to cart