Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LRTM1-leucine-rich repeats and transmembrane domains 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LRTM1-leucine-rich repeats and transmembrane domains 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC040732 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LRTM1 |
| Origin species: | Human |
| Product name: | LRTM1-leucine-rich repeats and transmembrane domains 1 Gene |
| Size: | 2ug |
| Accessions: | BC040732 |
| Gene id: | 57408 |
| Gene description: | leucine-rich repeats and transmembrane domains 1 |
| Synonyms: | HT017; leucine-rich repeat and transmembrane domain-containing protein 1; leucine rich repeats and transmembrane domains 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccttaaacttgtccaacaattccctttcaaatctggcccctggagctttccatgggcttcagcacttgcaggttttaaatctaacccagaattcactcctttccctggaaagcagacttttccattccctccctcagctgagggagcttgatttgtcatcaaacaacataagccaccttcccacatccttgggagagacttgggagaacctaactatacttgcggttcaacaaaaccagcttcagcagcttgatcgagcgctcctggaatccatgcccagtgtgaggcttttacttctcaaggacaacctctggaaatgcaattgccacttgctcggtcttaaactctggctggagaaatttgtctataaagggggactaacagacggcatcatctgtgaatcaccagacacctggaagggaaaggacctccttaggatccctcatgagctgtaccagccctgccctcttcctgctcctgatccagtgtcctcgcaggctcagtggcccggctctgcccacggtgtggtcctgaggcctcctgagaaccacaacgcgggggagcgagaactcttggagtgcgagctcaaacccaagccaaggccggccaacctgcgtcatgccattgccactgtcatcatcactggcgttgtgtgtgggattgtgtgtctcatgatgttggcagctgccatctatggctgcacctatgcggcaatcacagcccagtaccatgggggacccttggctcaaaccaatgatcctgggaaggtggaagaaaaagagcgatttgacagctcaccagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - succinate-CoA ligase, GDP-forming, beta subunit - fragile X mental retardation, autosomal homolog 2 - general transcription factor IIH, polypeptide 5 - zeta-chain (TCR) associated protein kinase 70kDa |