Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GTF2H5-general transcription factor IIH, polypeptide 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GTF2H5-general transcription factor IIH, polypeptide 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC060317 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GTF2H5 |
| Origin species: | Human |
| Product name: | GTF2H5-general transcription factor IIH, polypeptide 5 Gene |
| Size: | 2ug |
| Accessions: | BC060317 |
| Gene id: | 404672 |
| Gene description: | general transcription factor IIH, polypeptide 5 |
| Synonyms: | C6orf175; TFB5; TFIIH; TGF2H5; TTD; TTD-A; TTD3; TTDA; bA120J8.2; general transcription factor IIH subunit 5; TFB5 ortholog; TFIIH basal transcription factor complex TTD-A subunit; TFIIH basal transcription factor complex TTDA subunit; general transcription factor IIH, polypeptide 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcaacgtcttgaaaggagtgcttatagaatgtgatcctgccatgaagcagtttctgctgtacttggatgagtccaatgccctggggaagaagttcatcattcaagacattgatgacactcacgtctttgtaatagcagaattggttaatgtcctccaggagcgagtgggtgaattaatggaccaaaatgctttttcccttacccagaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zeta-chain (TCR) associated protein kinase 70kDa - NGFI-A binding protein 2 (EGR1 binding protein 2) - transmembrane emp24 domain trafficking protein 2 - protein tyrosine phosphatase type IVA, member 1 |