Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TMED2-transmembrane emp24 domain trafficking protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMED2-transmembrane emp24 domain trafficking protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025957 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMED2 |
| Origin species: | Human |
| Product name: | TMED2-transmembrane emp24 domain trafficking protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC025957 |
| Gene id: | 10959 |
| Gene description: | transmembrane emp24 domain trafficking protein 2 |
| Synonyms: | P24A; RNP24; p24; p24b1; p24beta1; transmembrane emp24 domain-containing protein 2; coated vesicle membrane protein; membrane protein p24A; p24 family protein beta-1; transmembrane emp24 domain trafficking protein 2; transmembrane p24 trafficking protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgacgcttgctgaactgctggtgctcctggccgctctcctggccacggtctcgggctatttcgttagcatcgacgcccatgctgaagagtgcttctttgagcgggtcacctcgggcaccaagatgggcctcatcttcgaggtggcggagggcggcttcctggacatcgacgtggagattacaggaccagataacaaaggaatttacaaaggagacagagaatccagtgggaaatacacatttgctgctcacatggatggaacatacaaattttgttttagtaaccggatgtccaccatgactccaaaaatagtgatgttcaccattgatattggggaggctccaaaaggacaagatatggaaacagaagctcaccagaacaagctagaagaaatgatcaatgagctagcagtggcgatgacagctgtaaagcacgaacaggaatacatggaagtccgggagagaatacacagagccatcaacgacaacacaaacagcagagtggtcctttggtccttctttgaagctcttgttctagttgccatgacattgggacagatctactacctgaagagattttttgaagtccggagagttgtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein tyrosine phosphatase type IVA, member 1 - centrosome and spindle pole associated protein 1 - fibronectin leucine rich transmembrane protein 3 - FXYD domain containing ion transport regulator 4 |