CSPP1-centrosome and spindle pole associated protein 1 Gene View larger

CSPP1-centrosome and spindle pole associated protein 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CSPP1-centrosome and spindle pole associated protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CSPP1-centrosome and spindle pole associated protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022867
Product type: DNA & cDNA
Ncbi symbol: CSPP1
Origin species: Human
Product name: CSPP1-centrosome and spindle pole associated protein 1 Gene
Size: 2ug
Accessions: BC022867
Gene id: 79848
Gene description: centrosome and spindle pole associated protein 1
Synonyms: JBTS21; centrosome and spindle pole-associated protein 1; centrosome and spindle pole associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagacagccttctcctatagttcctgctcttcagaacaaaattgcaagcaaactccaaagacctccttcagttgacagcatcatacattcctttattcatgaaagttccatgtccagggcacagtcacccccggtacctgccaggaaaaatcagctccgtgcagaagaggagaaaaaaaatgtaattatggaattatcagaaatgagaaaacagcttcgtagtgaagagaggcgtctacaagagcgattgctacacatggacagcgatgatgaaattcctatcaggaaaaaggaaaggaatcccatggatatatttgatatggctagacatcggttgcaagctcctgtcagaagacagtcccctaagggcttagacgctgccacttttcagaatgttcatgattttaatgagctgaaagatagagattcagaaacacgagttgatctgaaatttatgtacctggatcctccaagagatcatcacaccttagagattcagcagcaagccctgctaagagagcagcagaagaggctgaacagaataaaaatgcaggaaggtgccaaagttgacttagatgccatcccaagtgctaaagtacgagagcaaagaatgcccagagatgacactagtgatttcttgaaaaactcattattggaatctgatagtgcttttattggggcttacggtgagacatatcctgccattgaagatgacgtcctccctccaccatcacagttgccctctgcacgggagcgcaggaggaacaaacggaaaggactagacattgatagcagtcgtcctaatgtagcaccagatggtctctctctaaaatctatatccagtgtaaatgttgatgagcttagagtgagaaatgaggaacgaatgcgaagactgaatgaatttcacaataaacctattaatacagatgatgagagttcactggttgaccctgatgacatcatgaaacacataggggatgacggatcaaactctgtagcaactgagccctggctccgccctggcacttcagaaacgctgaaacgtttcatggcagagcagctgaaccaggagcagcagcagattcctggaaaaccaggcactttcacttggcagggcctgtcgactgcacatggttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fibronectin leucine rich transmembrane protein 3
- FXYD domain containing ion transport regulator 4
- CDC42 effector protein (Rho GTPase binding) 2
- triggering receptor expressed on myeloid cells 1

Buy CSPP1-centrosome and spindle pole associated protein 1 Gene now

Add to cart