Login to display prices
Login to display prices
SUCLG2-succinate-CoA ligase, GDP-forming, beta subunit Gene View larger

SUCLG2-succinate-CoA ligase, GDP-forming, beta subunit Gene

PTXBC047024

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SUCLG2-succinate-CoA ligase, GDP-forming, beta subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SUCLG2-succinate-CoA ligase, GDP-forming, beta subunit Gene

Proteogenix catalog: PTXBC047024
Ncbi symbol: SUCLG2
Product name: SUCLG2-succinate-CoA ligase, GDP-forming, beta subunit Gene
Size: 2ug
Accessions: BC047024
Gene id: 8801
Gene description: succinate-CoA ligase, GDP-forming, beta subunit
Synonyms: G-SCS; GBETA; GTPSCS; succinate--CoA ligase [GDP-forming] subunit beta, mitochondrial; GTP-specific succinyl-CoA synthetase beta subunit; GTP-specific succinyl-CoA synthetase subunit beta; SCS-betaG; succinyl-CoA ligase [GDP-forming] subunit beta, mitochondrial; succinyl-CoA ligase, GDP-forming, beta chain, mitochondrial; succinyl-CoA synthetase, beta-G chain; succinate-CoA ligase GDP-forming beta subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgacaacggagtgagagttcaaagattctttgtagcagacactgcaaatgaagctctcgaggctgctaagagactaaatgcaaaagaaattgttttaaaagcccagatcttagctggaggaagaggaaaaggtgtcttcaatagtggtttgaaaggaggtgttcatttaacaaaagaccctaatgttgtgggacagctggctaaacagatgattgggtacaatctagcgacaaaacaaactccaaaagaaggtgtgaaagttaacaaggtgatggttgctgaagccttggatatttccagagaaacctacctggcaattctgatggaccggtcctgcaatggccccgtgctggtgggcagcccccaggggggcgtcgacattgaagaggtggctgcttcaaacccggagctcatttttaaggagcaaattgacatttttgaaggaataaaggacagccaagctcagcggatggccgaaaatctaggcttcgttgggcctttgaaaagccaggctgcagatcaaattacgaagctgtataatctcttcctgaaaattgatgctactcaggtggaagtgaatccctttggtgaaactccagaaggacaagttgtctgttttgatgccaagataaactttgatgacaacgcagaattccgacaaaaagacatatttgctatggacgacaaatcagagaatgagcccattgaaaatgaagctgccaaatatgatctaaaatacataggactagatgggaacattgcctgctttgtgaatggtgctgggctcgccatggctacttgtgatatcattttccttaatggtgggaagccagccaacttcttggatcttggaggtggtgtaaaggaagctcaagtatatcaagcattcaaattgctcacagctgatcctaaggttgaagccatccttgtcaatatatttggtggtatcgtcaactgtgccatcattgccaatgggatcaccaaagcctgccgggagctagaactcaaggtgcccctggtggtccggcttgaaggaaccaacgtccaagaggcccagaagatactcaacaacagcggactccccattacttcagccattgacctggaggatgcagccaagaaggctgtggccagtgtggccaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: