TMEM116-transmembrane protein 116 Gene View larger

TMEM116-transmembrane protein 116 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM116-transmembrane protein 116 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM116-transmembrane protein 116 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC048796
Product type: DNA & cDNA
Ncbi symbol: TMEM116
Origin species: Human
Product name: TMEM116-transmembrane protein 116 Gene
Size: 2ug
Accessions: BC048796
Gene id: 89894
Gene description: transmembrane protein 116
Synonyms: transmembrane protein 116
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaacacacccagagtggacagagcacatctccactggtgatagattatacttgtcgagtttgtcaaatggcctttgttttctcaagcctgatacctctgctattgatgacacctgtattctgtctgggaaatactagtgaatgtttccaaaacttcagtcagagccacaagtgtatcttgatgcactcaccaccatcagccatggctgaacttccaccttctgccaacacatctgtctgtagcacactttatttttatggtatcgccattttcctgggcagctttgtactcagcctccttaccattatggtcttacttatccgagcccagacattgtataagaagtttgtgaagtcaactggctttctggggagtgaacagtgggcagtgattcacattgtggaccaacgggtgcgcttctacccggtggccttcttttgctgctggggcccagctgtcattctaatgatcataaagctgactaagccacaggacaccaagcttcacatggccctttatgttctccaggctctaacggcaacatctcagggtctactcaactgtggagtatatggctggacgcagcacaaattccaccaactaaagcaggaggctcggcgtgatgcagatacccagacaccattattatgctcacagaagagattctatagcaggggcttaaattcactggaatccaccctgacttttcctgccagtacttctaccattttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 150
- transmembrane protein 110
- popeye domain containing 2
- BCL2-associated athanogene 5

Buy TMEM116-transmembrane protein 116 Gene now

Add to cart