TMEM110-transmembrane protein 110 Gene View larger

TMEM110-transmembrane protein 110 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM110-transmembrane protein 110 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM110-transmembrane protein 110 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047015
Product type: DNA & cDNA
Ncbi symbol: TMEM110
Origin species: Human
Product name: TMEM110-transmembrane protein 110 Gene
Size: 2ug
Accessions: BC047015
Gene id: 375346
Gene description: transmembrane protein 110
Synonyms: STIM-activating enhancer encoded by TMEM110; STIMATE; store-operated calcium entry regulator STIMATE; transmembrane protein 110
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagggccccgccgggaacgcgagccggggactgccaggcgggccgccctccacagtcgcgtccggggcgggccgctgcgagagcggcgcgctcatgcacagcttcggcatcttcctgcaggggctgctcggcgtcgtggccttcagcacgttaatgctcaaacgcttcagagaaccaaagcatgaaagacgtccgtggaggatatggtttttagacacttccaaacaagccataggaatgctgttcatccactttgcaaatgtatacctagcagatctcactgaagaggacccttgttcactgtacctcatcaacttcctcctggacgccactgtgggcatgctgctcatctacgtgggggtgcgcgccgtcagcgtcctggtagagtggcagcagtgggagtccctgcgcttcggcgaatatggagaccctctgcagtgtggagcctgggtcgggcagtgcgctctttacatcgtgatcatgatttttgaaaagtctgtcgtcttcatcgtcctcctaatacttcagtggaaaaaggtggccctgttgaatcccattgaaaacccagacttgaagctggccatcgtcatgctgatcgtccccttctttgtcaacgctttgatgttttgggtagtggacaatttcctcatgagaaaggggaagacgaaagctaagctagaagaaaggggagccaaccaggactcgaggaatgggagcaaggtccgctaccggagggccgcatcccacgaggagtctgagtctgagatcctgatctcagcggatgatgagatggaggagtccgacgtggaggaggacctccgcagactgacccccctcaagcctgtgaagaaaaagaagcaccgctttgggctacccgtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - popeye domain containing 2
- BCL2-associated athanogene 5
- transmembrane protein 144
- transmembrane protein 173

Buy TMEM110-transmembrane protein 110 Gene now

Add to cart