Login to display prices
Login to display prices
TMEM150-transmembrane protein 150 Gene View larger

TMEM150-transmembrane protein 150 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM150-transmembrane protein 150 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM150-transmembrane protein 150 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050466
Product type: DNA & cDNA
Ncbi symbol: TMEM150
Origin species: Human
Product name: TMEM150-transmembrane protein 150 Gene
Size: 2ug
Accessions: BC050466
Gene id: 129303
Gene description: transmembrane protein 150
Synonyms: TMEM150; TTN1; transmembrane protein 150A; fasting-inducible integral membrane protein TM6P1; tentonin 1; transmembrane protein 150
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgcctggatcctcctgcctgtcagcctgtcagcgttctccatcactggcatatggactgtgtatgccatggctgtgatgaaccaccatgtatgccctgtggagaactggtcctacaacgagtcctgccctcctgaccctgctgagcaagggggtcccaagacctgctgcaccctggacgatgtccccctcatcagcaagtgtggctcctatcccccagaaagctgcctcttcagcctcattggcaacatgggtgctttcatggtggccctgatctgcctcctgcgctacgggcagctcctggagcagagtcggcactcttgggttaacaccacggcactcatcacaggctgcaccaacgctgcgggcctcttggtggttggcaactttcaggtggatcatgccaggtctctgcactacgttggagctggcgtggccttccctgcggggctgctctttgtttgcctgcactgtgctctctcctaccaaggggccaccgccccgctggacctggctgtggcctatctgcgaagtgtgctggctgtcatcgcctttatcaccctggtcctcagtggagtcttctttgtccatgagagttctcagctgcaacatggggcagccctgtgtgagtgggtgtgtgtcatcgatatcctcattttctatggcaccttcagctacgagtttggggcagtctcctcagacacactggtggctgcactgcagcctacccctggccgggcctgcaagtcctccgggagcagcagcacctccacccacctcaactgtgcccccgagagcatcgctatgatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 110
- popeye domain containing 2
- BCL2-associated athanogene 5
- transmembrane protein 144