Login to display prices
Login to display prices
SDC2-syndecan 2 Gene View larger

SDC2-syndecan 2 Gene

PTXBC049836

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SDC2-syndecan 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SDC2-syndecan 2 Gene

Proteogenix catalog: PTXBC049836
Ncbi symbol: SDC2
Product name: SDC2-syndecan 2 Gene
Size: 2ug
Accessions: BC049836
Gene id: 6383
Gene description: syndecan 2
Synonyms: CD362; HSPG; HSPG1; SYND2; syndecan-2; cell surface-associated heparan sulfate proteoglycan 1; fibroglycan; heparan sulfate proteoglycan 1, cell surface-associated; heparan sulfate proteoglycan core protein; syndecan proteoglycan 2; syndecan 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggcgcgcgtggatcctgctcaccttgggcttggtggcctgcgtgtcggcggagtcgagagcagagctgacatctgataaagacatgtaccttgacaacagctccattgaagaagcttcaggagtgtatcctattgatgacgatgactacgcttctgcgtctggctcgggagctgatgaggatgtagagagtccagagctgacaacaactcgaccacttccaaagatactgttgactagtgctgctccaaaagtggaaaccacgacgctgaatatacagaacaagatacctgctcagacaaagtcacctgaagaaactgataaagagaaagttcacctctctgactcagaaaggaaaatggacccagccgaagaggatacaaatgtgtatactgagaaacactcagacagtctgtttaaacggacagaagtcctagcagctgtcattgctggtggagttattggctttctctttgcaatttttcttatcctgctgttggtgtatcgcatgagaaagaaggatgaaggaagctatgaccttggagaacgcaaaccatccagtgctgcttatcagaaggcacctactaaggagttttatgcgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: