CCND1-cyclin D1 Gene View larger

CCND1-cyclin D1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCND1-cyclin D1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCND1-cyclin D1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC023620
Product type: DNA & cDNA
Ncbi symbol: CCND1
Origin species: Human
Product name: CCND1-cyclin D1 Gene
Size: 2ug
Accessions: BC023620
Gene id: 595
Gene description: cyclin D1
Synonyms: BCL1; D11S287E; PRAD1; U21B31; G1/S-specific cyclin-D1; B-cell CLL/lymphoma 1; B-cell lymphoma 1 protein; BCL-1 oncogene; PRAD1 oncogene
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacaccagctcctgtgctgcgaagtggaaaccatccgccgcgcgtaccccgatgccaacctcctcaacgaccgggtgctgcgggccatgctgaaggcggaggagacctgcgcgccctcggtgtcctacttcaaatgtgtgcagaaggaggtcctgccgtccatgcggaagatcgtcgccacctggatgctggaggtctgcgaggaacagaagtgcgaggaggaggtcttcccgctggccatgaactacctggaccgcttcctgtcgctggagcccgtgaaaaagagccgcctgcagctgctgggggccacttgcatgttcgtggcctctaagatgaaggagaccatccccctgacggccgagaagctgtgcatctacaccgacaactccatccggcccgaggagctgctgcaaatggagctgctcctggtgaacaagctcaagtggaacctggccgcaatgaccccgcacgatttcattgaacacttcctctccaaaatgccagaggcggaggagaacaaacagatcatccgcaaacacgcgcagaccttcgttgccctctgtgccacagatgtgaagttcatttccaatccgccctccatggtggcagcggggagcgtggtggccgcagtgcaaggcctgaacctgaggagccccaacaacttcctgtcctactaccgcctcacacgcttcctctccagagtgatcaagtgtgacccagactgcctccgggcctgccaggagcagatcgaagccctgctggagtcaagcctgcgccaggcccagcagaacatggaccccaaggccgccgaggaggaggaagaggaggaggaggaggtggacctggcttgcacacccaccgacgtgcgggacgtggacatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cyclin E1
- uromodulin
- syndecan 4
- claudin 8

Buy CCND1-cyclin D1 Gene now

Add to cart