Login to display prices
Login to display prices
SURF4-surfeit 4 Gene View larger

SURF4-surfeit 4 Gene

PTXBC018741

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SURF4-surfeit 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SURF4-surfeit 4 Gene

Proteogenix catalog: PTXBC018741
Ncbi symbol: SURF4
Product name: SURF4-surfeit 4 Gene
Size: 2ug
Accessions: BC018741
Gene id: 6836
Gene description: surfeit 4
Synonyms: ERV29; surfeit locus protein 4; surface 4 integral membrane protein; surfeit 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccagaacgacctgatgggcacggccgaggacttcgccgaccagttcctccgtgtcacaaagcagtacctgccccacgtggcgcgcctctgtctgatcagcaccttcctggaggacggcatccgtatgtggttccagtggagcgagcagcgcgactacatcgacaccacctggaactgcggctacctgctggcctcgtccttcgtcttcctcaacttgctgggacagctgactggctgcgtcctggtgttgagcaggaacttcgtgcagtacgcctgcttcgggctctttggaatcatagctctgcagacgattgcctacagcattttatgggacttgaagtttttgatgaggaacctggccctgggaggaggcctgttgctgctcctagcagaatcccgttctgaagggaagagcatgtttgcgggcgtccccaccatgcgtgagagctcccccaaacagtacatgcagctcggaggcagggtcttgctggttctgatgttcatgaccctccttcactttgacgccagcttcttttctattgtccagaacatcgtgggcacagctctgatgattttagtggccattggttttaaaaccaagctggctgctttgactcttgttgtgtggctctttgccatcaacgtatatttcaacgccttctggaccattccagtctacaagcccatgcatgacttcctgaaatacgacttcttccagaccatgtcggtgattgggggcttgctcctggtggtggccctgggccctgggggtgtctccatggatgagaagaagaaggagtggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: