Login to display prices
Login to display prices
RFPL2-ret finger protein-like 2 Gene View larger

RFPL2-ret finger protein-like 2 Gene

PTXBC051910

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RFPL2-ret finger protein-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RFPL2-ret finger protein-like 2 Gene

Proteogenix catalog: PTXBC051910
Ncbi symbol: RFPL2
Product name: RFPL2-ret finger protein-like 2 Gene
Size: 2ug
Accessions: BC051910
Gene id: 10739
Gene description: ret finger protein-like 2
Synonyms: RNF79; ret finger protein-like 2; RING finger protein 79; ret finger protein like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcactcttccaagaagcaagcagctgtcccgtctgctcagactatctggaaaaaccaatgtccctggagtgtggatgcgccgtctgcctcaagtgcattaattcactgcagaaggagccccatggggaggatctactttgctgttgctcttccatggtctctcggaagaacaaaatcaggcgcaatcggcagctagagaggctggcttcccacatcaaggaactggagcccaagctgaagaagattctgcagatgaacccaaggatgcggaagttccaagtggatatgaccttggatgccaacacagccaacaacttcctcctcatttctgacgacctcaggagcgtccgaagtgggcgcatcagacagaatcggcaagaccttgccgagagatttgacgtgtccgtttgcatcctgggctcccctcgctttacctgtggccgccactgctgggaggtggacgtgggaacaagcacagaatgggacctgggagtctgcagagaatctgttcaccgcaaagggaggatccagctgaccacagagcttggattctggactgtgagtttgagggatggaggccgcctctctgccaccacggtgccgctgactttcctcttcgtagaccgcaagttacagcgagtggggatttttctggatatgggcatgcagaacgtttccttttttgatgctgaaagtggttcccatgtctatacattcaggagcgtatctgctgaggagccattgcgcccatttttggctccttcagttccacctaatggtgatcaaggtgtcttgagcatctgtcctttgatgaactcaggcactactgatgctccagtccgtcctggggaggccaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: