RFPL2-ret finger protein-like 2 Gene View larger

RFPL2-ret finger protein-like 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RFPL2-ret finger protein-like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RFPL2-ret finger protein-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC051910
Product type: DNA & cDNA
Ncbi symbol: RFPL2
Origin species: Human
Product name: RFPL2-ret finger protein-like 2 Gene
Size: 2ug
Accessions: BC051910
Gene id: 10739
Gene description: ret finger protein-like 2
Synonyms: RNF79; ret finger protein-like 2; RING finger protein 79; ret finger protein like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcactcttccaagaagcaagcagctgtcccgtctgctcagactatctggaaaaaccaatgtccctggagtgtggatgcgccgtctgcctcaagtgcattaattcactgcagaaggagccccatggggaggatctactttgctgttgctcttccatggtctctcggaagaacaaaatcaggcgcaatcggcagctagagaggctggcttcccacatcaaggaactggagcccaagctgaagaagattctgcagatgaacccaaggatgcggaagttccaagtggatatgaccttggatgccaacacagccaacaacttcctcctcatttctgacgacctcaggagcgtccgaagtgggcgcatcagacagaatcggcaagaccttgccgagagatttgacgtgtccgtttgcatcctgggctcccctcgctttacctgtggccgccactgctgggaggtggacgtgggaacaagcacagaatgggacctgggagtctgcagagaatctgttcaccgcaaagggaggatccagctgaccacagagcttggattctggactgtgagtttgagggatggaggccgcctctctgccaccacggtgccgctgactttcctcttcgtagaccgcaagttacagcgagtggggatttttctggatatgggcatgcagaacgtttccttttttgatgctgaaagtggttcccatgtctatacattcaggagcgtatctgctgaggagccattgcgcccatttttggctccttcagttccacctaatggtgatcaaggtgtcttgagcatctgtcctttgatgaactcaggcactactgatgctccagtccgtcctggggaggccaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calcium binding protein 7
- transmembrane protein 25
- mannose phosphate isomerase
- phosphotriesterase related

Buy RFPL2-ret finger protein-like 2 Gene now

Add to cart