Login to display prices
Login to display prices
CABP7-calcium binding protein 7 Gene View larger

CABP7-calcium binding protein 7 Gene

PTXBC051805

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CABP7-calcium binding protein 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CABP7-calcium binding protein 7 Gene

Proteogenix catalog: PTXBC051805
Ncbi symbol: CABP7
Product name: CABP7-calcium binding protein 7 Gene
Size: 2ug
Accessions: BC051805
Gene id: 164633
Gene description: calcium binding protein 7
Synonyms: CALN2; calcium-binding protein 7; calneuron 2; calneuron II; calcium binding protein 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgttccacccggtgacggcggcgttgatgtaccggggcatctacaccgtgcccaacctgctgtcggagcagcgcccggtggacatcccggaggacgagctggaggagatccgagaggccttcaaggtgtttgaccgtgacggcaatggcttcatctccaagcaggagctgggcacagccatgcgctcactgggttacatgcccaacgaggtggagctggaggtcatcatccagcggctggacatggatggtgatggtcaagtggactttgaggagtttgtgacccttctgggacccaaactctccacctcagggatcccagagaagttccatggcaccgactttgatactgtcttctggaagtgcgacatgcagaagctgacggtggatgagctgaagcggctgctctacgacaccttctgcgagcacctgtccatgaaggacatagagaacatcatcatgacggaggaggagagccacctgggcacagccgaggagtgtcccgtggatgtggagacctgctccaaccagcagatccgccagacttgcgtgcgcaagagtctcatctgcgccttcgccatcgccttcatcatcagtgtcatgctcattgcggccaaccaggtgctgcgcagtggcatgaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: