TMEM25-transmembrane protein 25 Gene View larger

TMEM25-transmembrane protein 25 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM25-transmembrane protein 25 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM25-transmembrane protein 25 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC051841
Product type: DNA & cDNA
Ncbi symbol: TMEM25
Origin species: Human
Product name: TMEM25-transmembrane protein 25 Gene
Size: 2ug
Accessions: BC051841
Gene id: 84866
Gene description: transmembrane protein 25
Synonyms: transmembrane protein 25; 0610039J01Rik
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgcctccaggcccagccgccctccggcacacactgctgctcctgccagcccttctgagctcaggttggggggagttggagccacaaatagatggtcagacctgggctgagcgggcacttcgggagaatgaacgccacgccttcacctgccgggtggcaggggggcctggcacccccagattggcctggtatctggatggacagctgcaggaggccagcacctcaagactgctgagcgtgggaggggaggccttctctggaggcaccagcaccttcactgtcactgcccatcgggcccagcatgagctcaactgctctctgcaggaccccagaagtggccgatcagccaacgcctctgtcatccttaatgtgcaattcaagccagagattgcccaagtcggcgccaagtaccaggaagctcagggcccaggcctcctggttgtcctgtttgccctggtgcgtgccaacccgccggccaatgtcacctggatcgaccaggatgggccagtgactgtcaacacctctgacttcctggtgctggatgcgcagaactacccctggctcaccaaccacacggtgcagctgcagctccgcagcctggcacacaacctctcggtggtggccaccaatgacgtgggtgtcaccagtgcgtcgcttccagccccaggcccctcccggcacccatctctgatatcaagtgactccaacaacctaaaactcaacaacgtgcgcctgccacgggagaacatgtccctcccgtccaaccttcagctcaatgacctcactccagattccagagcagtgaaaccagcagaccggcagatggctcagaacaacagccggccagagcttctggacccggagcccggcggcctcctcaccagccgaggtttcatccgcctcccagtgctgggctatatctatcgagtgtccagcgtgagcagtgatgagatctggctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mannose phosphate isomerase
- phosphotriesterase related
- phospholipase A1 member A
- acetoacetyl-CoA synthetase

Buy TMEM25-transmembrane protein 25 Gene now

Add to cart