Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TRAPPC6B-trafficking protein particle complex 6B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRAPPC6B-trafficking protein particle complex 6B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047328 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRAPPC6B |
| Origin species: | Human |
| Product name: | TRAPPC6B-trafficking protein particle complex 6B Gene |
| Size: | 2ug |
| Accessions: | BC047328 |
| Gene id: | 122553 |
| Gene description: | trafficking protein particle complex 6B |
| Synonyms: | TPC6; trafficking protein particle complex subunit 6B; trafficking protein particle complex 6B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggatgaggcgttgtttttgcttctccataacgagatggtgtctggagtgtacaagtccgcggagcagggggaggtggaaaacggacgatgtattactaagctggaaaacatggggtttcgagtgggacaaggattgatagaaaggtttacaaaagatactgcaaggttcaaggatgagttagatatcatgaagttcatttgtaaagatttttggactacggtattcaagaaacaaatcgacaatctaaggacaaatcatcagtatttagcatttacgtgtggcttaatcagaggtggcttatcaaacttgggaataaaaagtattgtaacagctgaagtgtcttcaatgcctgcttgcaaatttcaggtgatgatacagaagctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein S19 binding protein 1 - collagen and calcium binding EGF domains 1 - transcription elongation factor A (SII), 2 - 2'-5'-oligoadenylate synthetase 2, 69/71kDa |