Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TCEA2-transcription elongation factor A (SII), 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TCEA2-transcription elongation factor A (SII), 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050623 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TCEA2 |
| Origin species: | Human |
| Product name: | TCEA2-transcription elongation factor A (SII), 2 Gene |
| Size: | 2ug |
| Accessions: | BC050623 |
| Gene id: | 6919 |
| Gene description: | transcription elongation factor A (SII), 2 |
| Synonyms: | TFIIS; transcription elongation factor A protein 2; testis-specific S-II; transcription elongation factor A (SII), 2; transcription elongation factor S-II protein 2; transcription elongation factor TFIIS.1; transcription elongation factor TFIIS.l; transcription elongation factor A2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgggcaaggaagaggagattgcgcggatcgcccggaggctggacaagatggtgaccaagaagagcgcggagggagccatggatttgctgcgggagctgaaggccatgcctatcacgctgcacctgctccagtccacccgagtcgggatgtctgtcaacgcccttcggaagcagagctcggatgaggaggtcattgcactggccaagtctctcatcaagtcctggaagaagctcctggatgcttccgatgccaaagccagggagcgggggaggggcatgcctctgcccacgtcctcgagggatgcctcagaggccccggatcccagccgcaagaggccggagctgcccagggcaccgtcgactccgaggatcaccacatttcctccggtgcctgtcacctgtgatgccgtgcgcaacaagtgccgcgagatgctgaccgctgccctgcagacggaccatgaccacgtggccatcggtgcggactgcgagcgcctgtcggctcagatcgaggaatatatcctttgggtaggggctgtgggcctgggtttctggtggagtcaggaggctgcctggcctggtgccctctggtggctgctggatgccactgcccagctgtccaggggtcacctgcctgggtggtcacctgcctgggtggtcaggctgtctcacctcaggagggcccccggaccagctgaagggctgattctgtctgcttgtggggcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 2'-5'-oligoadenylate synthetase 2, 69/71kDa - WNT1 inducible signaling pathway protein 2 - C-type lectin domain family 12, member A - hydroxysteroid (17-beta) dehydrogenase 7 |