No products
Prices are tax excluded
PTXBC037573
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC037573 |
Product type: | DNA & cDNA |
Ncbi symbol: | RPS19BP1 |
Origin species: | Human |
Product name: | RPS19BP1-ribosomal protein S19 binding protein 1 Gene |
Size: | 2ug |
Accessions: | BC037573 |
Gene id: | 91582 |
Gene description: | ribosomal protein S19 binding protein 1 |
Synonyms: | AROS; S19BP; active regulator of SIRT1; 40S ribosomal protein S19-binding protein 1; RPS19-binding protein 1; homolog of mouse S19 binding protein; ribosomal protein S19 binding protein 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgtccgccgccctgctgcggcggggcctggagctgctggcggcgtccgaggccccccgggaccctccaggtcaggccaagccgagaggggctccggtgaaacggccccggaagacgaaggcaattcaggcccagaaactgcggaactcggccaagggaaaggtgcccaagtcggcactggacgagtaccggaagcgagagtgtcgagaccacctcagagtaaacctgaagtttctgaccaggacgagaagcaccgtggctgagtctgtgagccagcagattttgcgccagaaccggggccgcaaggcctgtgaccggcctgtggccaagaccaagaagaagaaggctgagggcaccgtgttcaccgaggaagacttccagaagttccagcaggaatacttcggcagctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - collagen and calcium binding EGF domains 1 - transcription elongation factor A (SII), 2 - 2'-5'-oligoadenylate synthetase 2, 69/71kDa - WNT1 inducible signaling pathway protein 2 |