Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RPS19BP1-ribosomal protein S19 binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPS19BP1-ribosomal protein S19 binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC037573 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPS19BP1 |
| Origin species: | Human |
| Product name: | RPS19BP1-ribosomal protein S19 binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC037573 |
| Gene id: | 91582 |
| Gene description: | ribosomal protein S19 binding protein 1 |
| Synonyms: | AROS; S19BP; active regulator of SIRT1; 40S ribosomal protein S19-binding protein 1; RPS19-binding protein 1; homolog of mouse S19 binding protein; ribosomal protein S19 binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgccgccctgctgcggcggggcctggagctgctggcggcgtccgaggccccccgggaccctccaggtcaggccaagccgagaggggctccggtgaaacggccccggaagacgaaggcaattcaggcccagaaactgcggaactcggccaagggaaaggtgcccaagtcggcactggacgagtaccggaagcgagagtgtcgagaccacctcagagtaaacctgaagtttctgaccaggacgagaagcaccgtggctgagtctgtgagccagcagattttgcgccagaaccggggccgcaaggcctgtgaccggcctgtggccaagaccaagaagaagaaggctgagggcaccgtgttcaccgaggaagacttccagaagttccagcaggaatacttcggcagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - collagen and calcium binding EGF domains 1 - transcription elongation factor A (SII), 2 - 2'-5'-oligoadenylate synthetase 2, 69/71kDa - WNT1 inducible signaling pathway protein 2 |