Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GRID1-glutamate receptor, ionotropic, delta 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GRID1-glutamate receptor, ionotropic, delta 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047948 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GRID1 |
| Origin species: | Human |
| Product name: | GRID1-glutamate receptor, ionotropic, delta 1 Gene |
| Size: | 2ug |
| Accessions: | BC047948 |
| Gene id: | 2894 |
| Gene description: | glutamate receptor, ionotropic, delta 1 |
| Synonyms: | GluD1; glutamate receptor ionotropic, delta-1; gluR delta-1 subunit; glutamate receptor delta-1 subunit; glutamate ionotropic receptor delta type subunit 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacagcctcatggatgaagacattgctcacaagcagatttccccagcgtcgattgagctctcggccctggagatggggggcctggctcccacccagaccttggagccgacacgggagtaccagaacacccagctctcggtcagcacctttctgccagagcagagcagccatggcaccagccggacactctcatcagggcccagcagcaacctgccgctgccgctgagcagctcggcgaccatgccctccatgcagtgcaaacacaggtcacccaacggggggctgttccggcagagcccggtgaagacccccatccccatgtccttccagcccgtgcctggaggcgtccttccagaggctctggacacctcccacgggacctccatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mannosidase, alpha, class 1A, member 2 - CD3e molecule, epsilon (CD3-TCR complex) - NOP16 nucleolar protein homolog (yeast) - LSM14B, SCD6 homolog B (S. cerevisiae) |