PTXBC042057
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC042057 |
Product type: | DNA & cDNA |
Ncbi symbol: | PAPLN |
Origin species: | Human |
Product name: | PAPLN-papilin, proteoglycan-like sulfated glycoprotein Gene |
Size: | 2ug |
Accessions: | BC042057 |
Gene id: | 89932 |
Gene description: | papilin, proteoglycan-like sulfated glycoprotein |
Synonyms: | papilin; papilin, proteoglycan like sulfated glycoprotein |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcggctgctcctgctcgtgccgctgctgctggctccagcgcccgggtcctcggctcccaaggtgaggcggcagagtgacacctggggaccctggagccagtggagcccctgcagccggacctgtggagggggtgtcagcttccgggagcgcccctgctactcccagaggagagatggaggctccagctgcgtgggccccgcccggagccaccgctcttgtcgcacggagagctgccccgacggcgcccgggacttccgggccgagcagtgcgcggagttcgacggagcggagttccaggggcggcggtatcggtggctgccctactacagcgccccaaacaagtgtgaactgaactgcattcccaaagtgctgggattacaggcatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - Rho guanine nucleotide exchange factor (GEF) 7 - nuclear factor related to kappaB binding protein - leucine-rich repeats and transmembrane domains 1 - succinate-CoA ligase, GDP-forming, beta subunit |