No products
Prices are tax excluded
PTXBC060809
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC060809 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ELOVL2 |
| Origin species: | Human |
| Product name: | ELOVL2-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC060809 |
| Gene id: | 54898 |
| Gene description: | elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 |
| Synonyms: | 3-keto acyl-CoA synthase ELOVL2; SSC2; elongation of very long chain fatty acids protein 2; ELOVL FA elongase 2; elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2; very long chain 3-ketoacyl-CoA synthase 2; very long chain 3-oxoacyl-CoA synthase 2; ELOVL fatty acid elongase 2 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacatctaaaggcctttgatgatgaaatcaatgcttttttggacaatatgtttggaccgcgagattctcgagtcagagggtggttcatgttggactcttaccttcctaccttttttcttactgtcatgtatctgctctcaatatggctgggtaacaagtatatgaagaacagacctgctctttctctcaggggtatcctcaccttgtataatcttggaatcacacttctatccgcgtacatgctggcagagctcattctctccacttgggaaggaggctacaacttacagtgtcaagatcttaccagcgcaggggaagctgacatccgggtagccaaggtgctttggtggtactatttctccaaatcagtagagttcctggacacaattttcttcgttttgcggaaaaaaacgagtcagattacttttcttcatgtatatcatcatgcttctatgtttaacatctggtggtgtgtcttgaactggataccttgtggacaaagtttctttggaccaacactgaacagttttatccacattcttatgtactcctactatggactttctgtgtttccatctatgcacaagtatctttggtggaagaaatatctcacacaggctcagctggtgcagttcgtgctcgccatcacgcacaccatgagcgccgtcgtgaaaccgtgtggcttccccttcggttgtctcatcttccagtcatcttatatgctaacgttagtcatcctcttcttaaatttttacgttcagacataccgaaaaaagccaatgaagaaagatatgcaagagccacctgcagggaaagaagtgaagaatggtttttccaaagcctacttcactgcagcaaatggagtgatgaacaagaaagcacaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 - solute carrier family 7 (cationic amino acid transporter, y+ system), member 9 - sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) - solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 |