Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ARPC1A-actin related protein 2/3 complex, subunit 1A, 41kDa Gene
PTXBC039594
New product
Data sheet of ARPC1A-actin related protein 2/3 complex, subunit 1A, 41kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARPC1A-actin related protein 2/3 complex, subunit 1A, 41kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039594 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARPC1A |
| Origin species: | Human |
| Product name: | ARPC1A-actin related protein 2/3 complex, subunit 1A, 41kDa Gene |
| Size: | 2ug |
| Accessions: | BC039594 |
| Gene id: | 10552 |
| Gene description: | actin related protein 2/3 complex, subunit 1A, 41kDa |
| Synonyms: | Arc40; HEL-68; HEL-S-307; SOP2Hs; SOP2L; actin-related protein 2/3 complex subunit 1A; SOP2-like protein; actin binding protein (Schizosaccharomyces pombe sop2-like); actin related protein 2/3 complex, subunit 1A, 41kDa; epididymis luminal protein 68; epididymis secretory protein Li 307; actin related protein 2/3 complex subunit 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcactgcatcagtttttactagagccaatcacctgtcatgcctggaacagggatcgtactcagattgccctcagtcccaataatcacgaagtgcacatctataagaagaacgggagccagtgggtgaaagctcatgaactcaaggagcacaacggacacatcacaggtattgactgggctcccaagagcgaccgcattgtcacttgtggggcagaccgcaatgcctatgtctggagtcagaaagatggtgtttggaagccaaccctggtgatcctgagaattaatcgcgcagctacttttgtgaagtggtcccccctagagaacaaatttgctgtgggaagtggagcacgactcatttctgtttgttactttgagtctgaaaatgactggtgggtgagcaagcacattaaaaagccgattcgctccacagtcctcagcttggattggcatcccaacaacgttttgctggcagcaggatcatgtgacttcaaatgcagagtgttttctgcctacattaaagaagtggatgaaaagccagccagcacgccctggggcagcaagatgccttttgggcagctgatgtcagagtttggtggcagtggcactggtggctgggtccacggggtaagcttctctgccagtgggagccgcctggcctgggtcagccacgacagcaccgtgtctgttgctgatgcctcaaaaagtgtgcaggtctcgactctgaagacagagttcctgccgctcctaagtgtgtcatttgtctcagagaacagcgtcgtggctgctggccatgactgctgcccaatgctctttaactacgatgaccgcggctgcctgaccttcgtctccaagttagatattccaaaacagagcatccaacgcaacatgtctgccatggaacgcttccgcaacatggacaagagagccacaactgaggaccgcaacacggccttggagacgctgcaccagaatagcatcactcaagtctctatttatgaggtggacaagcaagattgtcgcaaattttgcactactggcatcgatggagccatgacaatttgggatttcaagaccctcgagtcttccatccagggcctccggataatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) subunit, beta type, 5 - wingless-type MMTV integration site family, member 5A - B-cell CLL/lymphoma 6, member B (zinc finger protein) - cleavage and polyadenylation specific factor 4, 30kDa |