Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMB5-proteasome (prosome, macropain) subunit, beta type, 5 Gene
PTXBC057840
New product
Data sheet of PSMB5-proteasome (prosome, macropain) subunit, beta type, 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMB5-proteasome (prosome, macropain) subunit, beta type, 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC057840 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMB5 |
| Origin species: | Human |
| Product name: | PSMB5-proteasome (prosome, macropain) subunit, beta type, 5 Gene |
| Size: | 2ug |
| Accessions: | BC057840 |
| Gene id: | 5693 |
| Gene description: | proteasome (prosome, macropain) subunit, beta type, 5 |
| Synonyms: | LMPX; MB1; proteasome subunit beta type-5; PSX large multifunctional protease X; macropain epsilon chain; multicatalytic endopeptidase complex epsilon chain; proteasome (prosome, macropain) subunit, beta type, 5; proteasome beta 5 subunit; proteasome catalytic subunit 3; proteasome chain 6; proteasome epsilon chain; proteasome subunit MB1; proteasome subunit X; proteasome subunit, beta type, 5; testicular tissue protein Li 153; proteasome subunit beta 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcttgccagcgtgttggagagaccgctaccggtgaaccagcgcgggtttttcggacttgggggtcgtgcagatctgctggatctaggtccagggagtctcagtgatggtctgagcctggccgcgccaggctggggtgtcccagaagagccaggaatcgaaatgcttcatggaacaaccaccctggccttcaagttccgccatggagtcatagttgcagctgactccagggctacagcgggtgcttacattgcctcccagacggtgaagaaggtgatagagatcaacccatacctgcttggcaccatggctgggggcgcagcggattgcagcttctgggaacggctgttggctcggcaatgtcgaatctatgagcttcgaaataaggaacgcatctctgtagcagctgcctccaaactgcttgccaacatggtgtatcagtacaaaggcatggggctgtccatgggcaccatgatctgtggctgggataagagaggccctggcctctactacgtggacagtgaagggaaccggatttcaggggccaccttctctgtaggttctggctctgtgtatgcatatggggtcatggatcggggctattcctatgacctggaagtggagcaggcctatgatctggcccgtcgagccatctaccaagccacctacagagatgcctactcaggaggtgcagtcaacctctaccacgtgcgggaggatggctggatccgagtctccagtgacaatgtggctgatctacatgagaagtatagtggctctaccccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - wingless-type MMTV integration site family, member 5A - B-cell CLL/lymphoma 6, member B (zinc finger protein) - cleavage and polyadenylation specific factor 4, 30kDa - feline leukemia virus subgroup C cellular receptor 1 |