CPSF4-cleavage and polyadenylation specific factor 4, 30kDa Gene View larger

CPSF4-cleavage and polyadenylation specific factor 4, 30kDa Gene

PTXBC050738

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CPSF4-cleavage and polyadenylation specific factor 4, 30kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CPSF4-cleavage and polyadenylation specific factor 4, 30kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050738
Product type: DNA & cDNA
Ncbi symbol: CPSF4
Origin species: Human
Product name: CPSF4-cleavage and polyadenylation specific factor 4, 30kDa Gene
Size: 2ug
Accessions: BC050738
Gene id: 10898
Gene description: cleavage and polyadenylation specific factor 4, 30kDa
Synonyms: CPSF30; NAR; NEB-1; NEB1; cleavage and polyadenylation specificity factor subunit 4; CPSF 30 kDa subunit; NS1 effector domain-binding protein 1; cleavage and polyadenylation specific factor 4, 30kDa; cleavage and polyadenylation specificity factor 30 kDa subunit; no arches homolog; no arches-like zinc finger protein; cleavage and polyadenylation specific factor 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggaaatcatcgccagcgtggaccacatcaagtttgacttggagatcgcggtggagcagcagctgggggcgcagccgctgcccttccccggcatggacaagtcgggcgctgctgtctgtgaattctttttgaaagctgcctgcggcaaagggggcatgtgtccgtttcgccacatcagtggtgagaagacagttgtgtgcaaacactggctgcgtggcctatgcaagaaaggggaccagtgtgagttcctgcatgagtatgacatgaccaagatgcccgagtgctacttctactccaagttcggggagtgcagcaacaaggaatgtcccttcctgcacatcgaccccgagtccaagatcaaggactgtccttggtatgaccgcggcttctgcaagcacggtcccctctgcaggcaccggcacacacggagagtcatctgtgtgaattacctcgtgggattctgcccggaggggccctcgtgtaaattcatgcaccctcgatttgaactgcccatgggaaccaccgagcagcccccactgccacagcagacacagcctccagcaaagagaaccccgcaggtcatcggggtcatgcagagtcaaaacagcagcgcgggcaaccggggaccccggccactggagcaggtcacctgttacaagtgtggcgagaaaggacactacgccaacagatgcaccaaagggcacttggcctttctcagtggacagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - feline leukemia virus subgroup C cellular receptor 1
- cytoplasmic polyadenylation element binding protein 1
- coenzyme Q3 homolog, methyltransferase (S. cerevisiae)
- leucine rich repeat (in FLII) interacting protein 2

Buy CPSF4-cleavage and polyadenylation specific factor 4, 30kDa Gene now

Add to cart