Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HS3ST1-heparan sulfate (glucosamine) 3-O-sulfotransferase 1 Gene
PTXBC057803
New product
Data sheet of HS3ST1-heparan sulfate (glucosamine) 3-O-sulfotransferase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HS3ST1-heparan sulfate (glucosamine) 3-O-sulfotransferase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC057803 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HS3ST1 |
| Origin species: | Human |
| Product name: | HS3ST1-heparan sulfate (glucosamine) 3-O-sulfotransferase 1 Gene |
| Size: | 2ug |
| Accessions: | BC057803 |
| Gene id: | 9957 |
| Gene description: | heparan sulfate (glucosamine) 3-O-sulfotransferase 1 |
| Synonyms: | 3OST; 3OST1; heparan sulfate glucosamine 3-O-sulfotransferase 1; 3-OST-1; h3-OST-1; heparan sulfate (glucosamine) 3-O-sulfotransferase 1; heparan sulfate 3-O-sulfotransferase 1; heparan sulfate D-glucosaminyl 3-O-sulfotransferase 1; heparin-glucosamine 3-O-sulfotransferase; heparan sulfate-glucosamine 3-sulfotransferase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgcgctgctcctgggcgcggtgctgctggtggcccagccccagctagtgccttcccgcaccgccgagctaggccagcaggagcttctgcggaaagcggggaccctccaggatgacgtccgcgatggcgtggccccaaacggctctgcccagcagttgccgcagaccatcatcatcggcgtgcgcaagggcggcacgcgcgcactgctggagatgctcagcctgcaccccgacgtggcggccgcggagaacgaggtccacttcttcgactgggaggagcattacagccacggcttgggctggtacctcagccagatgcccttctcctggccacaccagctcacagtggagaagacccccgcgtatttcacgtcgcccaaagtgcctgagcgagtctacagcatgaacccgtccatccggctgctgctcatcctgcgagacccgtcggagcgcgtgctatctgactacacccaagtgttctacaaccacatgcagaagcacaagccctacccgtccatcgaggagttcctggtgcgcgatggcaggctcaatgtggactacaaggccctcaaccgcagcctctaccacgtgcacatgcagaactggctgcgctttttcccgctgcgccacatccacattgtggacggcgaccgcctcatcagggaccccttccctgagatccaaaaggtcgagaggttcctaaagctgtcgccgcagatcaatgcttcgaacttctactttaacaaaaccaagggcttttactgcctgcgggacagcggccgggaccgctgcttacatgagtccaaaggccgggcgcacccccaagtcgatcccaaactactcaataaactgcacgaatattttcatgagccaaataagaagttcttcgagcttgttggcagaacatttgactggcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Ras association (RalGDS/AF-6) domain family member 5 - actin related protein 2/3 complex, subunit 1A, 41kDa - proteasome (prosome, macropain) subunit, beta type, 5 - wingless-type MMTV integration site family, member 5A |