Login to display prices
Login to display prices
NFAM1-NFAT activating protein with ITAM motif 1 Gene View larger

NFAM1-NFAT activating protein with ITAM motif 1 Gene

PTXBC038241

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NFAM1-NFAT activating protein with ITAM motif 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NFAM1-NFAT activating protein with ITAM motif 1 Gene

Proteogenix catalog: PTXBC038241
Ncbi symbol: NFAM1
Product name: NFAM1-NFAT activating protein with ITAM motif 1 Gene
Size: 2ug
Accessions: BC038241
Gene id: 150372
Gene description: NFAT activating protein with ITAM motif 1
Synonyms: NFAT activation molecule 1; calcineurin/NFAT-activating ITAM-containing protein; NFAT activating protein with ITAM motif 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctccctggccaacacagctatctccttcagctgcaggatcacctatccatacactccccaattcaaggttttcacagtcagctactttcatgaagatctccagggacagaggagccctaagaagccaacaaactgccaccctggactgggcacagagaaccagagccacaccctggactgccaggtcacccttgtgctgccgggagcatcggccactggcacctactactgctctgtccactggccacactccacggtgagaggcagcggcaccttcatcctggtcagagacgcagggtaccgagagcccccgcagagtccacagaagctcctgctctttggcttcaccggcctcctgagtgtcctgagtgtagtgggcacggccctgctgctctggaacaagaagcggatgcggggtccagggaaggaccccaccaggaagtgcccagatccaagatctgccagcagccccaagcagcatccttcagaatctgtctacacagctctgcagcgccgcgagaccgaggtctatgcctgcatcgagaatgaggatggcagctcacccaccgccaagcagagccccctctcccaggagagaccgcatagattcgaagatgatggcgaacttaacctggtctatgaaaatctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: