NR2C2AP-nuclear receptor 2C2-associated protein Gene View larger

NR2C2AP-nuclear receptor 2C2-associated protein Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NR2C2AP-nuclear receptor 2C2-associated protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NR2C2AP-nuclear receptor 2C2-associated protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC057837
Product type: DNA & cDNA
Ncbi symbol: NR2C2AP
Origin species: Human
Product name: NR2C2AP-nuclear receptor 2C2-associated protein Gene
Size: 2ug
Accessions: BC057837
Gene id: 126382
Gene description: nuclear receptor 2C2-associated protein
Synonyms: TRA16; nuclear receptor 2C2-associated protein; TR4 orphan receptor associated protein TRA16; TR4 orphan receptor-associated 16 kDa protein; repressor for TR4 transactivation; nuclear receptor 2C2 associated protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccactctttggtttgtccagagacagtgagcagggtgagttcagtgctgaatcgcaacactcggcagtttggaaaaaaacatcttttcgaccaggatgaggagacatgttggaactcagaccagggcccctcccagtgggtgacgctggagtttccccagctcatccgtgtctcccagctgcagatccagtttcagggtggcttctccagtcgccggggctgcctggaaggttcacagggcactcaggctctccacaagattgtagatttctaccctgaggacaacaactcgcttcagactttccccataccagctgctgaagtggaccggctgaaggtgacgtttgaggatgccactgacttttttggccgtgtggtcatctaccacctgcgggtgcttggggagaaggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - golgi autoantigen, golgin subfamily a, 7
- sterile alpha motif domain containing 4A
- CCR4-NOT transcription complex, subunit 7
- cAMP responsive element binding protein 5

Buy NR2C2AP-nuclear receptor 2C2-associated protein Gene now

Add to cart