Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NR2C2AP-nuclear receptor 2C2-associated protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NR2C2AP-nuclear receptor 2C2-associated protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC057837 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NR2C2AP |
| Origin species: | Human |
| Product name: | NR2C2AP-nuclear receptor 2C2-associated protein Gene |
| Size: | 2ug |
| Accessions: | BC057837 |
| Gene id: | 126382 |
| Gene description: | nuclear receptor 2C2-associated protein |
| Synonyms: | TRA16; nuclear receptor 2C2-associated protein; TR4 orphan receptor associated protein TRA16; TR4 orphan receptor-associated 16 kDa protein; repressor for TR4 transactivation; nuclear receptor 2C2 associated protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacccactctttggtttgtccagagacagtgagcagggtgagttcagtgctgaatcgcaacactcggcagtttggaaaaaaacatcttttcgaccaggatgaggagacatgttggaactcagaccagggcccctcccagtgggtgacgctggagtttccccagctcatccgtgtctcccagctgcagatccagtttcagggtggcttctccagtcgccggggctgcctggaaggttcacagggcactcaggctctccacaagattgtagatttctaccctgaggacaacaactcgcttcagactttccccataccagctgctgaagtggaccggctgaaggtgacgtttgaggatgccactgacttttttggccgtgtggtcatctaccacctgcgggtgcttggggagaaggtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - golgi autoantigen, golgin subfamily a, 7 - sterile alpha motif domain containing 4A - CCR4-NOT transcription complex, subunit 7 - cAMP responsive element binding protein 5 |