Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GOLGA7-golgi autoantigen, golgin subfamily a, 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GOLGA7-golgi autoantigen, golgin subfamily a, 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001227 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GOLGA7 |
| Origin species: | Human |
| Product name: | GOLGA7-golgi autoantigen, golgin subfamily a, 7 Gene |
| Size: | 2ug |
| Accessions: | BC001227 |
| Gene id: | 51125 |
| Gene description: | golgi autoantigen, golgin subfamily a, 7 |
| Synonyms: | GOLGA3AP1; GOLGA7A; HSPC041; golgin subfamily A member 7; Golgi complex-associated protein of 16kDa; golgi autoantigen, golgin subfamily a, 7; golgi complex-associated protein of 16 kDa; golgin A7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggccgcagcaggcgccggtgtccggaaaggtgttcattcagcgagactacagcagtggcacacgctgccagttccagaccaagttccctgcggagctggagaaccggattgataggcagcagtttgaagaaacagttcgaactctaaataacctttatgcagaagcagagaagctcggcggccagtcatatctcgaaggttgtttggcttgtttaacagcatataccatcttcctatgcatggaaactcattatgagaaggttctgaagaaagtctccaaatacattcaagagcagaatgagaagatctatgctccacaaggcctcctcctgacagaccctattgagcgaggactgcgagtttttagattgaaattaccatttatgaagacagaggcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sterile alpha motif domain containing 4A - CCR4-NOT transcription complex, subunit 7 - cAMP responsive element binding protein 5 - splicing factor, arginine/serine-rich 11 |