Login to display prices
Login to display prices
ACSL1-acyl-CoA synthetase long-chain family member 1 Gene View larger

ACSL1-acyl-CoA synthetase long-chain family member 1 Gene

PTXBC050073

New product

Data sheet of ACSL1-acyl-CoA synthetase long-chain family member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACSL1-acyl-CoA synthetase long-chain family member 1 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC050073
Ncbi symbol: ACSL1
Product name: ACSL1-acyl-CoA synthetase long-chain family member 1 Gene
Size: 2ug
Accessions: BC050073
Gene id: 2180
Gene description: acyl-CoA synthetase long-chain family member 1
Synonyms: ACS1; FACL1; FACL2; LACS; LACS1; LACS2; long-chain-fatty-acid--CoA ligase 1; LACS 1; LACS 2; acyl-CoA synthetase 1; fatty-acid-Coenzyme A ligase, long-chain 1; fatty-acid-Coenzyme A ligase, long-chain 2; lignoceroyl-CoA synthase; long-chain acyl-CoA synthetase 1; long-chain acyl-CoA synthetase 2; long-chain fatty acid-CoA ligase 2; long-chain fatty-acid-coenzyme A ligase 1; palmitoyl-CoA ligase 1; palmitoyl-CoA ligase 2; paltimoyl-CoA ligase 1; acyl-CoA synthetase long-chain family member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaagcccatgagctgttccggtattttcgaatgccagaactggttgacttccgacagtacgtgcgtactcttccgaccaacacgcttatgggcttcggagcttttgcagcactcaccaccttctggtacgccacgagacccaaacccctgaagccgccatgcgacctctccatgcagtcagtggaagtggcgggtagtggtggtgcacgaagatccgcactacttgacagcgacgagcccttggtgtatttctatgatgatgtcacaacattatacgaaggtttccagaggggaatacaggtgtcaaataatggcccttgtttaggctctcggaaaccagaccaaccctatgaatggctttcatataaacaggttgcagaattgtcggagtgcataggctcagcactgatccagaagggcttcaagactgccccagatcagttcattggcatctttgctcaaaatagacctgagtgggtgattattgaacaaggatgctttgcttattcgatggtgatcgttccactttatgatacccttggaaatgaagccatcacgtacatagtcaacaaagctgaactctctctggtttttgttgacaagccagagaaggccaaactcttattagagggtgtagaaaataagttaataccaggccttaaaatcatagttgtcatggatgcctacggcagtgaactggtggaacgaggccagaggtgtggggtggaagtcaccagcatgaaggcgatggaggacctgggaagagccaacagacggaagcccaagcctccagcacctgaagatcttgcagtaatttgtttcacaagtggaactacaggcaaccccaaaggagcaatggtcactcaccgaaacatagtgagcgattgttcagcttttgtgaaagcaacagagaatacagtcaatccttgcccagatgatactttgatatctttcttgcctctcgcccatatgtttgagagagttgtagagtgtgtaatgctgtgtcatggagctaaaatcggatttttccaaggagatatcaggctgctcatggatgacctcaaggtgcttcaacccactgtcttccccgtggttccaagactgctgaaccggatgtttgaccgaattttcggacaagcaaacaccacgctgaagcgatggctcttggactttgcctccaagaggaaagaagcagagcttcgcagcggcatcatcagaaacaacagcctgtgggaccggctgatcttccacaaagtacagtcgagcctgggcggaagagtccggctgatggtgacaggagccgccccggtgtctgccactgtgctgacgttcctcagagcagccctgggctgtcagttttatgaaggatacggacagacagagtgcactgccgggtgctgcctaaccatgcctggagactggaccgcaggccatgttggggccccgatgccgtgcaatttgataaaacttgttgatgtggaagaaatgaattacatggctgccgagggcgagggcgaggtgtgtgtgaaagggccaaatgtatttcagggctacttgaaggacccagcgaaaacagcagaagctttggacaaagacggctggttacacacaggggacattggaaaatggttaccaaatggcaccttgaaaattatcgaccggaaaaagcacatatttaagctggcacaaggagaatacatagcccctgaaaagattgaaaatatctacatgcgaagtgagcctgttgctcaggtgtttgtccacggagaaagcctgcaggcatttctcattgcaattgtggtaccagatgttgagacattatgttcctgggcccaaaagagaggatttgaagggtcgtttgaggaactgtgcagaaataaggatgtcaaaaaagctatcctcgaagatatggtgagacttgggaaggattctggtctgaaaccatttgaacaggtcaaaggcatcacattgcaccctgaattattttctatcgacaatggccttctgactccaacaatgaaggcgaaaaggccagagctgcggaactatttcaggtcgcagatagatgacctctattccactatcaaggtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: