No products
Prices are tax excluded
PTXBC060806
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC060806 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RECK |
| Origin species: | Human |
| Product name: | RECK-reversion-inducing-cysteine-rich protein with kazal motifs Gene |
| Size: | 2ug |
| Accessions: | BC060806 |
| Gene id: | 8434 |
| Gene description: | reversion-inducing-cysteine-rich protein with kazal motifs |
| Synonyms: | ST15; reversion-inducing cysteine-rich protein with Kazal motifs; membrane-anchored glycoprotein (metastasis and invasion); suppression of tumorigenicity 15 (reversion-inducing-cysteine-rich protein with kazal motifs); suppression of tumorigenicity 5 (reversion-inducing-cysteine-rich protein with kazal motifs); suppressor of tumorigenicity 15 protein; reversion inducing cysteine rich protein with kazal motifs |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgaccgtccgggcctctctgcgaggtgcgctgccccttctgctggccgtgacgggggtcgcggaggtggcagggggcctggctccgggcagtgcgggtgcattgtgttgtaatcattcaaaggataaccaaatgtgccgtgatgtatgtgaacagattttctcctcaaaaagtgaatcccgactaaaacatctgttgcagcgagccccagattattgcccagagacaatggttgaaatttggaattgtatgaattcatctttgccaggtgtgtttaagaagtctgatggctgggttggcttaggctgctgtgaactggctattgccttggagtgtcgacaggcatgcaagcaggcatcttcaaagaatgatatttccaaagtttgcagaaaagaatatgagaatgctcttttcagttgcattagcagaaatgaaatgggctcggtttgttgcagttatgcaggtcatcacacaaactgccgagaatactgtcaagccatttttcgaacagactcttctcctggtccatctcagataaaagcagtggaaaattattgcgcctctattagtccacaattaatacattgtgtgaacaattatactcaatcttatccaatgaggaacccaacggatatgtttgaattttttgccaatgagcaattattacttttgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - protein kinase, AMP-activated, alpha 1 catalytic subunit - ribosomal modification protein rimK-like family member A - protein kinase, AMP-activated, alpha 1 catalytic subunit - transmembrane emp24 protein transport domain containing 4 |