Cart 33 Product Products 7 866,30 € (empty)
-
1 x HIATL1-hip...121,50 € -
-
1 x PIP4K2A-ph...121,50 € -
1 x FAM177A1-f...113,40 € -
1 x DUSP6-dual...121,50 € -
1 x S100B-S100...113,40 € -
1 x NCOA7-nucl...113,40 € -
-
-
1 x PIP4K2B-ph...121,50 € -
1 x FAM176A-fa...113,40 € -
1 x ZZZ3-zinc...121,50 € -
1 x PIPOX-pipe...121,50 € -
1 x PIK3R5-pho...121,50 € -
1 x GPR1-G...121,50 € -
-
1 x RPA3-repli...113,40 € -
1 x DYNLRB1-dy...113,40 € -
1 x PIM1-pim-1...121,50 € -
1 x FAM133A-fa...113,40 € -
-
-
1 x RPL13-ribo...113,40 € -
1 x DUSP7-dual...121,50 € -
1 x PIPOX-pipe...121,50 € -
1 x PID1-phosp...113,40 € -
1 x TMEM116-tr...113,40 € -
1 x DYNLRB2-dy...113,40 € -
1 x FAM128B-fa...113,40 € -
-
-
-
No products
To be determined Shipping
7 866,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 33 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 866,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 866,30 €
View larger 
RIMKLA-ribosomal modification protein rimK-like family member A Gene
PTXBC039737
New product
Data sheet of RIMKLA-ribosomal modification protein rimK-like family member A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RIMKLA-ribosomal modification protein rimK-like family member A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039737 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RIMKLA |
| Origin species: | Human |
| Product name: | RIMKLA-ribosomal modification protein rimK-like family member A Gene |
| Size: | 2ug |
| Accessions: | BC039737 |
| Gene id: | 284716 |
| Gene description: | ribosomal modification protein rimK-like family member A |
| Synonyms: | FAM80A; NAAGS; NAAGS-II; N-acetylaspartylglutamate synthase A; N-acetylaspartyl-glutamate synthetase A; N-acetylaspartylglutamate synthetase II; N-acetylaspartylglutamylglutamate synthase A; NAAG synthetase A; RP11-157D18.1; family with sequence similarity 80, member A; ribosomal protein S6 modification-like protein A; ribosomal modification protein rimK like family member A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaccagatcgccgtcaccatcgtcggcggccacctcggcctccagctaaaccagaaggccctcaccactttcccggatgtggtgcttgtacgggtacccacaccctcagtgcagtcagacagtgacatcactgtcctgcgacacctggagaagctgggctgccggttggtcaatcgcccacagagcatcttaaattgcatcaacaaattctggacgttccaagaactggctggacatggggtccccatgccagacaccttctcctatggtgggcatgaagacttttcaaaaatgattgatgaagctgagcccctgggctacccagtcgtggtgaagagcacacgaggccaccggggaaaagctgtttttctggcaagagataaacatcacctctctgacatctgccatctgatccgccacgatgtgccctacctgttccagaagtacgtgaaggagtcccatggaaaggacatccgggtggtggtggtagggggccaggtcataggctctatgcttcgctgctccactgatggacggatgcagagcaactgctctctcggtggcgtgggcgtcaagtgtccgctgacagaacaaggcaagcagttggctattcaggtgtccaacatcctaggcatggacttctgtggcattgatctccttatcatggacgatggctcctttgtggtgtgtgaggcaaatgctaatgttggcttcctagcctttgaccaggcatgcaacttagatgtgggtgggatcattgcagactataccatgtccttgctgccaaataggcagactggaaagatggctgtcctcccaggactgtcgagtccaagggagaagaacgagccggatggctgtgcttcagctcagggagttgcagagagcgtctataccatcaacagtgggtctacctctagcgaaagtgagcctgaactgggagagatccgggattcctcagcaagcacaatgggggccccaccctccatgctgcccgaacctggctacaacattaacaacaggattgcttctgagttaaaacttaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein kinase, AMP-activated, alpha 1 catalytic subunit - transmembrane emp24 protein transport domain containing 4 - N-ethylmaleimide-sensitive factor attachment protein, beta - par-6 partitioning defective 6 homolog beta (C. elegans) |