Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TMED4-transmembrane emp24 protein transport domain containing 4 Gene
PTXBC057851
New product
Data sheet of TMED4-transmembrane emp24 protein transport domain containing 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMED4-transmembrane emp24 protein transport domain containing 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC057851 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMED4 |
| Origin species: | Human |
| Product name: | TMED4-transmembrane emp24 protein transport domain containing 4 Gene |
| Size: | 2ug |
| Accessions: | BC057851 |
| Gene id: | 222068 |
| Gene description: | transmembrane emp24 protein transport domain containing 4 |
| Synonyms: | ERS25; GMP25iso; HNLF; p24a3; p24alpha3; transmembrane emp24 domain-containing protein 4; endoplasmic reticulum stress-response protein 25 kDa; p24 family protein alpha-3; transmembrane emp24 protein transport domain containing 4; transmembrane p24 trafficking protein 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaggtgtcggggctgggcctctgcgggcgatggggcggcaggccctgctgcttctcgcgctgtgcgccacaggcgcccaggggctctacttccacatcggcgagaccgagaagcgctgtttcatcgaggaaatccccgacgagaccatggtcatcggcaactatcgtacccagatgtgggataagcagaaggaggtcttcctgccctcgacccctggcctgggcatgcacgtggaagtgaaggaccccgacggcaaggtggtgctgtcccggcagtacggctcggagggccgcttcacgttcacctcccacacgcccggtgaccatcaaatctgtctgcactccaattctaccaggatggctctcttcgctggtggcaaactgcgggtgcatctcgacatccaggttggggagcatgccaacaactaccctgagattgctgcaaaagataagctgacggagctacagctccgcgcccgccagttgcttgatcaggtggaacagattcagaaggagcaggattaccaaaggtatcgtgaagagcgcttccgactgacgagcgagagcaccaaccagagggtcctatggtggtccattgctcagactgtcatcctcatcctcactggcatctggcagatgcgtcacctcaagagcttctttgaggccaagaagctggtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-ethylmaleimide-sensitive factor attachment protein, beta - par-6 partitioning defective 6 homolog beta (C. elegans) - TNF receptor-associated factor 3 interacting protein 1 - receptor (G protein-coupled) activity modifying protein 3 |