Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GCLM-glutamate-cysteine ligase, modifier subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GCLM-glutamate-cysteine ligase, modifier subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC041809 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GCLM |
| Origin species: | Human |
| Product name: | GCLM-glutamate-cysteine ligase, modifier subunit Gene |
| Size: | 2ug |
| Accessions: | BC041809 |
| Gene id: | 2730 |
| Gene description: | glutamate-cysteine ligase, modifier subunit |
| Synonyms: | GLCLR; glutamate--cysteine ligase regulatory subunit; GCS light chain; GSC light chain; gamma-ECS regulatory subunit; gamma-glutamylcysteine synthetase regulatory subunit; glutamate-cysteine ligase (gamma-glutamylcysteine synthetase), regulatory (30.8kD); glutamate-cysteine ligase modifier subunit delta2 alternative splicing; glutamate-cysteine ligase regulatory protein; glutamate-cysteine ligase modifier subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcaccgacagccgcgcggccaaggcgctcctggcgcgggcccgcaccctgcacctgcagacggggaacctgctgaactggggccgcctgcggaagaagtgcccgtccacgcacagcgaggagcttcatgattgtatccaaaaaaccttgaatgaatggagttcccaaatcaacccagatttggtcagggagtttccagatgtcttggaatgcactgtatctcatgcagtagaaaagataaatcctgatgaaagagaagaaatgaaagtttctgcaaaactgttcattgtagaatcaaactcttcatcatcaactagaagtgcagttgacatggcctgttcagtccttggagttgcacagctggattctgtgatcattgcttcacctcctattgaagatggagttaatctttccttggagcatttacagccttactgggaggaattagaaaacttagttcagagcaaaaagattgttgccataggtacctctgatctagacaaaacacagttggaacagctgtatcagtgggcacaggtaaaaccaaatagtaaccaagttaatcttgcctcctgctgtgtgatgccaccagatttgactgcatttgctaaacaatttgacatacagctgttgactcacaatgatccaaaagaactgctttctgaagcaagtttccaagaagctcttcaggaaagcattcctgacattcaagcgcacgagtgggtgccgctgtggctactgcggtattcggtcattgtgaaaagtagaggaattatcaaatcaaaaggctacattttacaagctaaaagaaggggttcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interleukin-1 receptor-associated kinase 3 - sodium channel, nonvoltage-gated 1, gamma - LIM homeobox transcription factor 1, alpha - outer dense fiber of sperm tails 3-like 1 |