SCNN1G-sodium channel, nonvoltage-gated 1, gamma Gene View larger

SCNN1G-sodium channel, nonvoltage-gated 1, gamma Gene


New product

Data sheet of SCNN1G-sodium channel, nonvoltage-gated 1, gamma Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SCNN1G-sodium channel, nonvoltage-gated 1, gamma Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC059391
Product type: DNA & cDNA
Ncbi symbol: SCNN1G
Origin species: Human
Product name: SCNN1G-sodium channel, nonvoltage-gated 1, gamma Gene
Size: 2ug
Accessions: BC059391
Gene id: 6340
Gene description: sodium channel, nonvoltage-gated 1, gamma
Synonyms: BESC3; ENaCg; ENaCgamma; PHA1; SCNEG; amiloride-sensitive sodium channel subunit gamma; ENaC gamma subunit; amiloride-sensitive epithelial sodium channel gamma subunit; amiloride-sensitive sodium channel gamma-subunit; epithelial Na(+) channel subunit gamma; gamma-ENaC; gamma-NaCH; nonvoltage-gated sodium channel 1 subunit gamma; sodium channe epithelial 1 gamma subunit; sodium channel, non-voltage-gated 1, gamma subunit; sodium channel, nonvoltage-gated 1, gamma; sodium channel epithelial 1 gamma subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacccggagagaagatcaaagccaaaatcaagaagaatctgcccgtgacgggccctcaggcgccgaccattaaagagctgatgcggtggtactgcctcaacaccaacacccatggctgtcgccgcatcgtggtgtcccgcggccgtctgcgccgcctcctctggatcgggttcacactgactgccgtggccctcatcctctggcagtgcgccctcctcgtcttctccttctatactgtctcagtttccatcaaagtccacttccggaagctggattttcctgcagtcaccatctgcaacatcaacccctacaagtacagcaccgttcgccaccttctagctgacttggaacaggagaccagagaggccctgaagtccctgtatggctttccagagtcccggaagcgccgagaggcggagtcctggaactccgtctcagagggaaagcagcctagattctcccaccggattccgctgctgatctttgatcaggatgagaagggcaaggccagggacttcttcacagggaggaagcggaaagtcggcggtagcatcattcacaaggcttcaaatgtcatgcacatcgagtccaagcaagtggtgggattccaactgtgctcaaatgacacctccgactgtgccacctacaccttcagctcgggaatcaatgccattcaggagtggtataagctacactacatgaacatcatggcacaggtgcctctggagaagaaaatcaacatgagctattctgctgaggagctgctggtgacctgcttctttgatggagtgtcctgtgatgccaggaatttcacgcttttccaccacccgatgcatgggaattgctatactttcaacaacagagaaaatgagaccattctcagcacctccatggggggcagcgaatatgggctgcaagtcattttgtacataaacgaagaggaatacaacccattcctcgtgtcctccactggagctaaggtgatcatccatcggcaggatgagtatcccttcgtcgaagatgtgggaacagagattgagacagcaatggtcacctctataggaatgcacctgacagagtccttcaagctgagtgagccctacagtcagtgcacggaggacgggagtgacgtgccaatcaggaacatctacaacgctgcctactcgctccagatctgccttcattcatgcttccagacaaagatggtggagaaatgtgggtgtgcccagtacagccagcctctacctcctgcagccaactactgcaactaccagcagcaccccaactggatgtattgttactaccaactgcatcgagcctttgtccaggaagagctgggctgccagtctgtgtgcaaggaagcctgcagctttaaagagtggacactaaccacaagcctggcacaatggccatctgtggtttcggagaagtggttgctgcctgttctcacttgggaccaaggccggcaagtaaacaaaaagctcaacaagacagacttggccaaactcttgatattctacaaagacctgaaccagagatccatcatggagagcccagccaacagtattgagatgcttctgtccaacttcggtggccagctgggcctgtggatgagctgctctgttgtctgcgtcatcgagatcatcgaggtcttcttcattgacttcttctctatcattgcccgccgccagtggcagaaagccaaggagtggtgggcctggaaacaggctcccccatgtccagaagctccccgtagcccacagggccaggacaatccagccctggatatagacgatgacctacccactttcaactctgctttgcacctgcctccagccctaggaacccaagtgcccggcacaccgccccccaaatacaataccttgcgcttggagagggccttttccaaccagctcacagatacccagatgctggatgagctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LIM homeobox transcription factor 1, alpha
- outer dense fiber of sperm tails 3-like 1
- bactericidal/permeability-increasing protein
- CREB regulated transcription coactivator 1

Buy SCNN1G-sodium channel, nonvoltage-gated 1, gamma Gene now

Add to cart