Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LMX1A-LIM homeobox transcription factor 1, alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LMX1A-LIM homeobox transcription factor 1, alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066353 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LMX1A |
| Origin species: | Human |
| Product name: | LMX1A-LIM homeobox transcription factor 1, alpha Gene |
| Size: | 2ug |
| Accessions: | BC066353 |
| Gene id: | 4009 |
| Gene description: | LIM homeobox transcription factor 1, alpha |
| Synonyms: | LMX1; LMX1.1; LIM homeobox transcription factor 1-alpha; LIM/homeobox protein 1.1; LIM homeobox transcription factor 1 alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaggaatcatgaacccctacacggctctgcccaccccacagcagctcctggccatcgagcagagtgtctacagctcagatcccttccgacagggtctcaccccaccccagatgcctggagaccacatgcacccttatggtgccgagccccttttccatgacctggatagcgacgacacctccctcagtaacctgggtgactgtttcctagcaacctcagaagctgggcctctgcagtccagagtgggaaaccccattgaccatctgtactccatgcagaattcttacttcacatcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - outer dense fiber of sperm tails 3-like 1 - bactericidal/permeability-increasing protein - CREB regulated transcription coactivator 1 - glycosyltransferase 1 domain containing 1 |