Login to display prices
Login to display prices
LMX1A-LIM homeobox transcription factor 1, alpha Gene View larger

LMX1A-LIM homeobox transcription factor 1, alpha Gene

PTXBC066353

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LMX1A-LIM homeobox transcription factor 1, alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LMX1A-LIM homeobox transcription factor 1, alpha Gene

Proteogenix catalog: PTXBC066353
Ncbi symbol: LMX1A
Product name: LMX1A-LIM homeobox transcription factor 1, alpha Gene
Size: 2ug
Accessions: BC066353
Gene id: 4009
Gene description: LIM homeobox transcription factor 1, alpha
Synonyms: LMX1; LMX1.1; LIM homeobox transcription factor 1-alpha; LIM/homeobox protein 1.1; LIM homeobox transcription factor 1 alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaggaatcatgaacccctacacggctctgcccaccccacagcagctcctggccatcgagcagagtgtctacagctcagatcccttccgacagggtctcaccccaccccagatgcctggagaccacatgcacccttatggtgccgagccccttttccatgacctggatagcgacgacacctccctcagtaacctgggtgactgtttcctagcaacctcagaagctgggcctctgcagtccagagtgggaaaccccattgaccatctgtactccatgcagaattcttacttcacatcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: