Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
YSK4-YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae) Gene
PTXBC034417
New product
Data sheet of YSK4-YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about YSK4-YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034417 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | YSK4 |
| Origin species: | Human |
| Product name: | YSK4-YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC034417 |
| Gene id: | 80122 |
| Gene description: | YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae) |
| Synonyms: | YSK4 Sps1/Ste20-related kinase homolog; SPS1/STE20-related protein kinase YSK4; YSK4; RCK; mitogen-activated protein kinase kinase kinase 19; regulated in COPD kinase; regulated in COPD, protein kinase; yeast Sps1/Ste20-related kinase 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtttgttcctggtggctcaatctctagtattataaaccgttttgggccattgcctgagatggtgttctgtaaatatacgaaacaaatacttcaaggtgttgcttatctccatgagaactgtgtggtacatcgcgatatcaaaggaaataatgttatgctcatgccaactggaataataaagctgattgactttggctgtgccaggcgtttggcctgggcaggtttaaatggcacccacagtgacatgcttaagtccatgcatgggactccatattggatggccccagaagtcatcaatgagtctggctatggacggaaatcagatatctggagcattggttgtactgtgtttgagatggctacagggaagcctccactggcttccatggacaggatggccgccatgttttacatcggagcacaccgagggctgatgcctcctttaccagaccacttctcagaaaatgcagcagactttgtgcgcatgtgcctgaccaggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nucleophosmin (nucleolar phosphoprotein B23, numatrin) - signal recognition particle receptor (docking protein) - olfactory receptor, family 2, subfamily L, member 13 - poly(A)-specific ribonuclease (deadenylation nuclease) |