Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OR2L13-olfactory receptor, family 2, subfamily L, member 13 Gene
PTXBC028158
New product
Data sheet of OR2L13-olfactory receptor, family 2, subfamily L, member 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OR2L13-olfactory receptor, family 2, subfamily L, member 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028158 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OR2L13 |
| Origin species: | Human |
| Product name: | OR2L13-olfactory receptor, family 2, subfamily L, member 13 Gene |
| Size: | 2ug |
| Accessions: | BC028158 |
| Gene id: | 284521 |
| Gene description: | olfactory receptor, family 2, subfamily L, member 13 |
| Synonyms: | OR2L14; olfactory receptor 2L13; olfactory receptor 2L14; olfactory receptor, family 2, subfamily L, member 14; olfactory receptor family 2 subfamily L member 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaaatggaatcacacttcaaatgatttcattttgttgggtctgcttcccccaaatcaaactggaatatttctcttgtgccttatcatcctcatattctttctggcctcggtgggtaactcggccatgattcacctcatccacgtggatcctcgtctccacacaccgatgtactttcttctcagccagctctcccttatggacctgatgtacatctccaccaccgtccccaagatggcgtacaacttcctgtccggccagaaaggcatctccttcctgggatgtggtgtgcaaagcttcttcttcctgaccatggcgtgttctgaaggcttactcctgacctccatggcctacgaccgttatttggccatctgccactctctctattatcctatccgcatgagtaaaatgatgtgtgtgaagatgattggaggctcttggacactggggtccatcaactccttggcacacacagtctttgcccttcatattccctactgcaggtctagggctattgaccatttcttctgcgatgtcccagccatgttgcttcttgcctgtacagatacttgggtctatgaatatatggtttttgtaagtacaagcctctttctccttttccctttcattggcatcacttcttcctgtggccgagtcctatttgctgtctatcatatgcactcaaaggaggggagaaaaaaggccttcaccaccatttcaacacatttaactgtagtgatcttttactatgcaccttttgtctacacctatcttcggcccaggaatctccgctcaccagctgaagacaagatcctggcagtcttctacaccatccttacccccatgctcaatcccattatctacagcctgaggaataaggaagtcctgggggctatgaggagagtgtttgggatattctctttcctgaaagaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - poly(A)-specific ribonuclease (deadenylation nuclease) - transforming, acidic coiled-coil containing protein 1 - heparan sulfate (glucosamine) 3-O-sulfotransferase 1 - Ras association (RalGDS/AF-6) domain family member 5 |