Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene
PTXBC003670
New product
Data sheet of NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003670 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NPM1 |
| Origin species: | Human |
| Product name: | NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene |
| Size: | 2ug |
| Accessions: | BC003670 |
| Gene id: | 4869 |
| Gene description: | nucleophosmin (nucleolar phosphoprotein B23, numatrin) |
| Synonyms: | B23; NPM; nucleophosmin; nucleolar protein NO38; nucleophosmin (nucleolar phosphoprotein B23, numatrin); nucleophosmin/nucleoplasmin family, member 1; testicular tissue protein Li 128 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgtacagccaacggtttcccttgggggctttgaaataacaccaccagtggtcttaaggttgaagtgtggttcagggccagtgcatattagtggacagcacttagtagctgtggaggaagatgcagagtcagaagatgaagaggaggaggatgtgaaactcttaagtatatctggaaagcggtctgcccctggaggtggtagcaaggttccacagaaaaaagtaaaacttgctgctgatgaagatgatgacgatgatgatgaagaggatgatgatgaagatgatgatgatgatgattttgatgatgaggaagctgaagaaaaagcgccagtgaagaaatctatacgagatactccagccaaaaatgcacaaaagtcaaatcagaatggaaaagactcaaaaccatcatcaacaccaagatcaaaaggacaagaatccttcaagaaacaggaaaaaactcctaaaacaccaaaaggacctagttctgtagaagacattaaagcaaaaatgcaagcaagtatagaaaaaggtggttctcttcccaaagtggaagccaaattcatcaattatgtgaagaattgcttccggatgactgaccaagaggctattcaagatctctggcagtggaggaagtctctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signal recognition particle receptor (docking protein) - olfactory receptor, family 2, subfamily L, member 13 - poly(A)-specific ribonuclease (deadenylation nuclease) - transforming, acidic coiled-coil containing protein 1 |