GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene View larger

GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene

PTXBC013997

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013997
Product type: DNA & cDNA
Ncbi symbol: GNB5
Origin species: Human
Product name: GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene
Size: 2ug
Accessions: BC013997
Gene id: 10681
Gene description: guanine nucleotide binding protein (G protein), beta 5
Synonyms: GB5; IDDCA; LADCI; guanine nucleotide-binding protein subunit beta-5; G protein, beta subunit 5L; G protein, beta-5 subunit; gbeta5; guanine nucleotide binding protein (G protein), beta 5; guanine nucleotide-binding protein, beta subunit 5L; transducin beta chain 5; G protein subunit beta 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaccgaggggctgcacgagaacgagacgctggcgtcgctgaagagcgaggccgagagcctcaagggcaagctggaggaggagcgagccaagctgcacgatgtggagctgcaccaggtggcggagcgggtggaggccctggggcagtttgtcatgaagaccagaaggaccctcaaaggccacgggaacaaagtcctgtgcatggactggtgcaaagataagaggaggatcgtgagctcgtcacaggatgggaaggtgatcgtgtgggattccttcaccacaaacaaggagcacgcggtcaccatgccctgcacgtgggtgatggcatgtgcttatgccccatcgggatgtgccattgcttgtggtggtttggataataagtgttctgtgtaccccttgacgtttgacaaaaatgaaaacatggctgccaaaaagaagtctgttgctatgcacaccaactacctgtcggcctgcagcttcaccaactctgacatgcagatcctgacagcgagcggcgatggcacatgtgccctgtgggacgtggagagcgggcagctgctgcagagcttccacggacatggggctgacgtcctctgcttggacctggccccctcagaaactggaaacaccttcgtgtctgggggatgtgacaagaaagccatggtgtgggacatgcgctccggccagtgcgtgcaggcctttgaaacacatgaatctgacatcaacagtgtccggtactaccccagtggagatgcctttgcttcagggtcagatgacgctacgtgtcgcctctatgacctgcgggcagatagggaggttgccatctattccaaagaaagcatcatatttggagcatccagcgtggacttctccctcagtggtcgcctgctgtttgctggatacaatgattacactatcaacgtctgggatgttctcaaagggtcccgggtctccatcctgtttggacatgaaaaccgcgttagcactctacgagtttcccccgatgggactgctttctgctctggatcatgggatcataccctcagagtctgggcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae)
- YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)
- nucleophosmin (nucleolar phosphoprotein B23, numatrin)
- signal recognition particle receptor (docking protein)

Buy GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene now

Add to cart