Login to display prices
Login to display prices
ENPP6-ectonucleotide pyrophosphatase/phosphodiesterase 6 Gene View larger

ENPP6-ectonucleotide pyrophosphatase/phosphodiesterase 6 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ENPP6-ectonucleotide pyrophosphatase/phosphodiesterase 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ENPP6-ectonucleotide pyrophosphatase/phosphodiesterase 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035035
Product type: DNA & cDNA
Ncbi symbol: ENPP6
Origin species: Human
Product name: ENPP6-ectonucleotide pyrophosphatase/phosphodiesterase 6 Gene
Size: 2ug
Accessions: BC035035
Gene id: 133121
Gene description: ectonucleotide pyrophosphatase/phosphodiesterase 6
Synonyms: NPP6; ectonucleotide pyrophosphatase/phosphodiesterase family member 6; B830047L21Rik; E-NPP 6; GPC-Cpde; NPP-6; choline-specific glycerophosphodiester phosphodiesterase; glycerophosphocholine cholinephosphodiesterase; ectonucleotide pyrophosphatase/phosphodiesterase 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagtgaagcttgggaccctcctgctggcccttgccctgggcctggcccagccagcctctgcccgccggaagctgctggtgtttctgctggatggttttcgctcagactacatcagtgatgaggcgctggagtcattgcctggtttcaaagagattgtgagcaggggagtaaaagtggattacttgactccagacttccctagtctctcgtatcccaattattataccctaatgactggccgccattgtgaagtccatcagatgatcgggaactacatgtgggaccccaccaccaacaagtcctttgacattggcgtcaacaaagacagcctaatgcctctctggtggaatggatcagaacctctgtgggtcactctgaccaaggccaaaaggaaggtctacatgtactactggccaggctgtgaggttgagattctgggtgtcagacccacctactgcctagaatataaaaatgtcccaacggatatcaattttgccaatgcagtcagcgatgctcttgactccttcaagagtggccgggccgacctggcagccatataccatgagcgcattgacgtggaaggccaccactacgggcctgcatctccgcagaggaaagatgccctcaaggctgtagacactgtcctgaagtacatgaccaagtggatccaggagcggggcctgcaggaccgcctgaacgtcattattttctcggatcacggaatgaccgacattttctggatggacaaagtgattgagctgaataagtacatcagcctgaatgacctgcagcaagtgaaggaccgcgggcctgttgtgagcctttggccggcccctgggaaacactctgagatatataacaaactgagcacagtggaacacatgactgtctacgagaaagaagccatcccaagcaggttctattacaagaaaggaaagtttgtctctcctttgactttagtggctgatgaaggctggttcataactgagaatcgagagatgcttccgttttggatgaacagcaccggcaggcgggaaggttggcagcgtggatggcacggctacgacaacgagctcatggacatgcggggcatcttcctggccttcggacctgatttcaaatccaacttcagagctgctcctatcaggtcggtggacgtctacaatgtcatgtgcaatgtggtgggcatcaccccgctgcccaacaacggatcctggtccagggtgatgtgcatgctgaagggccgcgccagcactgccccgcctgtctggcccagccactgtgccctggcactgattcttctcttcctgcttgcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATG4 autophagy related 4 homolog C (S. cerevisiae)
- adaptor-related protein complex 2, alpha 1 subunit
- CKLF-like MARVEL transmembrane domain containing 8
- ligand dependent nuclear receptor corepressor-like