Login to display prices
Login to display prices
ACTA1-actin, alpha 1, skeletal muscle Gene View larger

ACTA1-actin, alpha 1, skeletal muscle Gene

PTXBC012597

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTA1-actin, alpha 1, skeletal muscle Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACTA1-actin, alpha 1, skeletal muscle Gene

Proteogenix catalog: PTXBC012597
Ncbi symbol: ACTA1
Product name: ACTA1-actin, alpha 1, skeletal muscle Gene
Size: 2ug
Accessions: BC012597
Gene id: 58
Gene description: actin, alpha 1, skeletal muscle
Synonyms: ACTA; ASMA; CFTD; CFTD1; CFTDM; MPFD; NEM1; NEM2; NEM3; SHPM; actin, alpha skeletal muscle; nemaline myopathy type 3; actin, alpha 1, skeletal muscle
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcgacgaagacgagaccaccgccctcgtgtgcgacaatggctccggcctggtgaaagccggcttcgccggggatgacgcccctagggccgtgttcccgtccatcgtgggccgcccccgacaccagggcgtcatggtcggtatgggtcagaaagattcctacgtgggcgacgaggctcagagcaagagaggtatcctgaccctgaagtaccctatcgagcacggcatcatcaccaactgggatgacatggagaagatctggcaccacaccttctacaacgagcttcgcgtggctcccgaggagcaccccaccctgctcaccgaggcccccctcaatcccaaggccaaccgcgagaagatgacccagatcatgtttgagaccttcaacgtgcccgccatgtacgtggccatccaggccgtgctgtccctctacgcctccggcaggaccaccggcatcgtgctggactccggcgacggcgtcacccacaacgtgcccatttatgagggctacgcgctgccgcacgccatcatgcgcctggacctggcgggccgcgatctcaccgactacctgatgaagatcctcactgagcgtggctactccttcgtgaccacagctgagcgcgagatcgtgcgcgacatcaaggagaagctgtgctacgtggccctggacttcgagaacgagatggcgacggccgcctcctcctcctccctggaaaagagctacgagctgccagacgggcaggtcatcaccatcggcaacgagcgcttccgctgcccggagacgctcttccagccctccttcatcggtatggagtcggcgggcattcacgagaccacctacaacagcatcatgaagtgtgacatcgacatcaggaaggacctgtatgccaacaacgtcatgtcggggggcaccacgatgtaccctgggatcgctgaccgcatgcagaaagagatcaccgcgctggcacccagcaccatgaagatcaagatcatcgccccgccggagcgcaaatactcggtgtggatcggcggctccatcctggcctcgctgtccaccttccagcagatgtggatcaccaagcaggagtacgacgaggccggcccttccatcgtccaccgcaaatgcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: