Login to display prices
Login to display prices
MAGEA10-melanoma antigen family A, 10 Gene View larger

MAGEA10-melanoma antigen family A, 10 Gene

PTXBC004105

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAGEA10-melanoma antigen family A, 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAGEA10-melanoma antigen family A, 10 Gene

Proteogenix catalog: PTXBC004105
Ncbi symbol: MAGEA10
Product name: MAGEA10-melanoma antigen family A, 10 Gene
Size: 2ug
Accessions: BC004105
Gene id: 4109
Gene description: melanoma antigen family A, 10
Synonyms: CT1.10; MAGE10; melanoma-associated antigen 10; MAGE-10 antigen; cancer/testis antigen 1.10; cancer/testis antigen family 1, member 10; melanoma antigen family A, 10; melanoma antigen family A10; MAGE family member A10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctcgagctccaaagcgtcagcgctgcatgcctgaagaagatcttcaatcccaaagtgagacacagggcctcgagggtgcacaggctcccctggctgtggaggaggatgcttcatcatccacttccaccagctcctcttttccatcctcttttccctcctcctcctcttcctcctcctcctcctgctatcctctaataccaagcaccccagaggaggtttctgctgatgatgagacaccaaatcctccccagagtgctcagatagcctgctcctccccctcggtcgttgcttcccttccattagatcaatctgatgagggctccagcagccaaaaggaggagagtccaagcaccctacaggtcctgccagacagtgagtctttacccagaagtgagatagatgaaaaggtgactgatttggtgcagtttctgctcttcaagtatcaaatgaaggagccgatcacaaaggcagaaatactggagagtgtcataaaaaattatgaagaccacttccctttgttgtttagtgaagcctccgagtgcatgctgctggtctttggcattgatgtaaaggaagtggatcccactggccactcctttgtccttgtcacctccctgggcctcacctatgatgggatgctgagtgatgtccagagcatgcccaagactggcattctcatacttatcctaagcataatcttcatagagggctactgcacccctgaggaggtcatctgggaagcactgaatatgatggggctgtatgatgggatggagcacctcatttatggggagcccaggaagctgctcacccaagattgggtgcaggaaaactacctggagtaccggcaggtgcctggcagtgatcctgcacggtatgagtttctgtggggtccaagggctcatgctgaaattaggaagatgagtctcctgaaatttttggccaaggtaaatgggagtgatccaagatccttcccactgtggtatgaggaggctttgaaagatgaggaagagagagcccaggacagaattgccaccacagatgatactactgccatggccagtgcaagttctagcgctacaggtagcttctcctaccctgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: