MAGEA10-melanoma antigen family A, 10 Gene View larger

MAGEA10-melanoma antigen family A, 10 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAGEA10-melanoma antigen family A, 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAGEA10-melanoma antigen family A, 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004105
Product type: DNA & cDNA
Ncbi symbol: MAGEA10
Origin species: Human
Product name: MAGEA10-melanoma antigen family A, 10 Gene
Size: 2ug
Accessions: BC004105
Gene id: 4109
Gene description: melanoma antigen family A, 10
Synonyms: CT1.10; MAGE10; melanoma-associated antigen 10; MAGE-10 antigen; cancer/testis antigen 1.10; cancer/testis antigen family 1, member 10; melanoma antigen family A, 10; melanoma antigen family A10; MAGE family member A10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctcgagctccaaagcgtcagcgctgcatgcctgaagaagatcttcaatcccaaagtgagacacagggcctcgagggtgcacaggctcccctggctgtggaggaggatgcttcatcatccacttccaccagctcctcttttccatcctcttttccctcctcctcctcttcctcctcctcctcctgctatcctctaataccaagcaccccagaggaggtttctgctgatgatgagacaccaaatcctccccagagtgctcagatagcctgctcctccccctcggtcgttgcttcccttccattagatcaatctgatgagggctccagcagccaaaaggaggagagtccaagcaccctacaggtcctgccagacagtgagtctttacccagaagtgagatagatgaaaaggtgactgatttggtgcagtttctgctcttcaagtatcaaatgaaggagccgatcacaaaggcagaaatactggagagtgtcataaaaaattatgaagaccacttccctttgttgtttagtgaagcctccgagtgcatgctgctggtctttggcattgatgtaaaggaagtggatcccactggccactcctttgtccttgtcacctccctgggcctcacctatgatgggatgctgagtgatgtccagagcatgcccaagactggcattctcatacttatcctaagcataatcttcatagagggctactgcacccctgaggaggtcatctgggaagcactgaatatgatggggctgtatgatgggatggagcacctcatttatggggagcccaggaagctgctcacccaagattgggtgcaggaaaactacctggagtaccggcaggtgcctggcagtgatcctgcacggtatgagtttctgtggggtccaagggctcatgctgaaattaggaagatgagtctcctgaaatttttggccaaggtaaatgggagtgatccaagatccttcccactgtggtatgaggaggctttgaaagatgaggaagagagagcccaggacagaattgccaccacagatgatactactgccatggccagtgcaagttctagcgctacaggtagcttctcctaccctgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - matrix-remodelling associated 8
- TBC1 domain family, member 20
- glycogen synthase kinase 3 beta
- immunoglobulin heavy constant mu

Buy MAGEA10-melanoma antigen family A, 10 Gene now

Add to cart