DTNBP1-dystrobrevin binding protein 1 Gene View larger

DTNBP1-dystrobrevin binding protein 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DTNBP1-dystrobrevin binding protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DTNBP1-dystrobrevin binding protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011912
Product type: DNA & cDNA
Ncbi symbol: DTNBP1
Origin species: Human
Product name: DTNBP1-dystrobrevin binding protein 1 Gene
Size: 2ug
Accessions: BC011912
Gene id: 84062
Gene description: dystrobrevin binding protein 1
Synonyms: BLOC1S8; DBND; HPS7; My031; SDY; dysbindin; BLOC-1 subunit 8; Hermansky-Pudlak syndrome 7 protein; biogenesis of lysosomal organelles complex-1, subunit 8; biogenesis of lysosome-related organelles complex 1 subunit 8; dysbindin-1; dystrobrevin binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggagacccttcgcgagcggctgctgagcgtgcagcaggatttcacctccgggctgaagactttaagtgacaagtcaagagaagcaaaagtgaaaagcaaacccaggactgttccatttttgccaaagtactctgctggattagaattacttagcaggtatgaggatacatgggctgcacttcacagaagagccaaagactgtgcaagtgctggagagctggtggatagcgaggtggtcatgctttctgcgcactgggagaagaaaaagacaagcctcgtggagctgcaagagcagctccagcagctcccagctttaatcgcagacttagaatccatgacagcaaatctgactcatttagaggcgagttttgaggaggtagagaacaacctgctgcatctggaagacttatgtgggcagtgtgaattagaaagatgcaaacatatgcagtcccagcaactggagaattacaagaaaaataagaggaaggaacttgaaaccttcaaagctgaactagatgcagagcacgcccagaaggtcctggaaatggagcacacccagcaaatgaagctgaaggagcggcagaagttttttgaggaagccttccagcaggacatggagcagtacctgtccactggctacctgcagattgcagagcggcgagagcccataggcagcatgtcatccatggaagtgaacgtggacatgctggagcagatggacctgatggacatatcggaccaggaggccctggacgtcttcctgaactctggaggagaagagaacactgtgctgtcccccgccttagggcctgaatccagtacctgtcagaatgagattaccctccaggttccaaatccctcagaattaagagccaagccaccttcttcttcctccacctgcaccgactcggccacccgggacatcagtgagggtggggagtcccccgttgttcagtccgatgaggaggaagttcaggtggacactgccctggccacatcacacactgacagagaggccactccggatggtggtgaggacagcgactcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanoma antigen family A, 10
- matrix-remodelling associated 8
- TBC1 domain family, member 20
- glycogen synthase kinase 3 beta

Buy DTNBP1-dystrobrevin binding protein 1 Gene now

Add to cart