Login to display prices
Login to display prices
DMRTC2-DMRT-like family C2 Gene View larger

DMRTC2-DMRT-like family C2 Gene

PTXBC029202

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DMRTC2-DMRT-like family C2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DMRTC2-DMRT-like family C2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029202
Product type: DNA & cDNA
Ncbi symbol: DMRTC2
Origin species: Human
Product name: DMRTC2-DMRT-like family C2 Gene
Size: 2ug
Accessions: BC029202
Gene id: 63946
Gene description: DMRT-like family C2
Synonyms: doublesex- and mab-3-related transcription factor C2; DMRT like family C2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacccagtgacatgcctgctggctaccactgccccttagactctgccccctgggatgagaccagagacccccagagcacagagctgatccccaggagagccatcagccgctctccaacctgcgcccgctgccgcaaccatggtgtcaccgcccatctcaagggccacaagcgcctctgcctcttccaggcttgcgagtgtcacaaatgtgtcctcatcctggagcgccgcagggtcatggctgcccaggtggccttgcgtaggcagcaggaggcgcagctaaagaagcacctgatgaggagaggggaagcctctcccaaagctcccaaccacttcagaaagggaaccactcagccacaggtcccctctggaaaggagaacatagcaccccagcctcagaccccccatggggcagtcctgctggcaccgacaccccccgggaagaactcctgtgggcctctgctgctcagccatcccccggaagcctcgcccttgtcctggactccggtgcctcctggcccttgggtccctggacactggctgcctccaggcttctccatgccaccaccagtggtgtgccgcctgctgtaccaagaacctgctgtctctctgcctcccttccctggctttgaccctggcacctccctccagctgcccactcatgggcccttcaccacctgcccaggatctcacccagtactgacagctcctctttctggagagccccaagggccccctagccagccccgcacacactcaactctgatactccagccctgtggcaccccagaccctcttcagctacagccacaggcctctggagcctcgtgcctggcccggacatctggcccctcagagtggcagctgcagcaagaggcagctgaagccctcgtggggctgaaagattcatcccaggctcctcgtgtgaccccttctgtgccccccaaccctgcctggatctccctgcttcacccctgtggcccaccagctcctgctggaggaagaggattccagcctgttggcccctgtcttcgacccagcccagccccctctgttgctctgcatattggccgtctggggtccatctccctcctgagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NCK adaptor protein 2
- antizyme inhibitor 1
- lactation elevated 1
- plastin 1 (I isoform)