NCK2-NCK adaptor protein 2 Gene View larger

NCK2-NCK adaptor protein 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NCK2-NCK adaptor protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NCK2-NCK adaptor protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000103
Product type: DNA & cDNA
Ncbi symbol: NCK2
Origin species: Human
Product name: NCK2-NCK adaptor protein 2 Gene
Size: 2ug
Accessions: BC000103
Gene id: 8440
Gene description: NCK adaptor protein 2
Synonyms: cytoplasmic protein NCK2; GRB4; NCKbeta; SH2/SH3 adaptor protein NCK-beta; growth factor receptor-bound protein 4; noncatalytic region of tyrosine kinase, beta; NCK adaptor protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagaagaagttattgtgatagccaagtgggactacaccgcccagcaggaccaggagctggacatcaagaagaacgagcggctgtggttgctggacgactccaagacgtggtggcgggtgaggaacgcggccaacaggacgggctatgtaccgtccaactacgtggagcggaagaacagcctgaagaagggctccctcgtgaagaacctgaaggacacactaggcctcggcaagacgcgcaggaagaccagcgcgcgggatgcgtcccccacgcccagcacggacgccgagtaccccgccaatggcagcggcgccgaccgcatctacgacctcaacatcccggccttcgtcaagttcgcctatgtggccgagcgggaggatgagttgtccctggtgaaggggtcgcgcgtcaccgtcatggagaagtgcagcgacggttggtggcggggcagctacaacgggcagatcggctggttcccctccaactacgtcttggaggaggtggacgaggcggctgcggagtccccaagcttcctgagcctgcgcaagggcgcctcgctgagcaatggccagggctcccgcgtgctgcatgtggtccagacgctgtaccccttcagctcagtcaccgaggaggagctcaacttcgagaagggggagaccatggaggtgattgagaagccggagaacgaccccgagtggtggaaatgcaaaaatgcccggggccaggtgggcctcgtccccaaaaactacgtggtggtcctcagtgacgggcctgccctgcaccctgcgcacgccccacagataagctacaccgggccctcgtccagcgggcgcttcgcgggcagagagtggtactacgggaacgtgacgcggcaccaggccgagtgcgccctcaacgagcggggcgtggagggcgacttcctcattagggacagcgagtcctcgcccagcgacttctccgtgtcccttaaagcgtcagggaagaacaaacacttcaaggtgcagctcgtggacaatgtctactgcattgggcagcggcgcttccacaccatggacgagctggtggaacactacaaaaaggcgcccatcttcaccagcgagcacggggagaagctctacctcgtcagggccctgcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - antizyme inhibitor 1
- lactation elevated 1
- plastin 1 (I isoform)
- choline dehydrogenase

Buy NCK2-NCK adaptor protein 2 Gene now

Add to cart