AZIN1-antizyme inhibitor 1 Gene View larger

AZIN1-antizyme inhibitor 1 Gene

PTXBC013420

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AZIN1-antizyme inhibitor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AZIN1-antizyme inhibitor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013420
Product type: DNA & cDNA
Ncbi symbol: AZIN1
Origin species: Human
Product name: AZIN1-antizyme inhibitor 1 Gene
Size: 2ug
Accessions: BC013420
Gene id: 51582
Gene description: antizyme inhibitor 1
Synonyms: AZI; AZIA1; OAZI; OAZIN; ODC1L; antizyme inhibitor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaggatttattgatgatgcaaactactccgttggcctgttggatgaaggaacaaaccttggaaatgttattgataactatgtttatgaacataccctgacagggaaaaatgcattttttgtgggagatcttggaaagattgtgaagaaacacagtcaatggcagaatgtagtggctcagataaagccattctacacagtgaagtgcaactctgctccagctgtacttgagattttggcagctcttggaaccggatttgcttgttccagtaaaaatgaaatggctttagtgcaagagttgggtgtacctccagaaaacattatttacataagtccttgcaagcaagtgtctcagataaagtatgcagcaaaagttggagtgaatatcctgacatgtgacaatgaaattgaattgaagaaaattgcacgtaatcacccaaatgccaaggtcttactacatattgcaacagaagataatattggaggtgaagagggtaacatgaagtttggcactaccctgaagaactgtaggcatctcttggaatgtgctaaggaacttgatgtccaaataattggggttaaatttcatgtttcgagtgcttgcaaagaatctcaagtatatgtacatgctctatctgatgctcgatgtgtgtttgacatggctggagaaattggctttacgatgaacatgttagacattggtggaggattcacgggaactgaatttcaattggaagaggttaatcatgttatcagccctctgttggatatctactttcctgaaggatctggtgttaagataatttcagaacccggaagctactatgtgtcttctgcatttacactcgcagttaatatcatagcaaagaaagttgttgaaaatgataaatttccctctggagtagaaaaaaccggaagtgatgaaccagccttcatgtattatatgaatgatggtgtttatggttcttttgcaagtaaactgtctgaggacttaaataccattccagaggttcacaagaaatacaaggaagatgagcctctgtttacaagcagcctttggggtccatcctgtgatgagcttgatcaaattgtggaaagctgtcttcttcctgagctgaatgtgggagattggcttatctttgataacatgggagcagattctttccatgaaccatctgcttttaatgattttcagaggccagccatttattacatgatgtcattcagtgattggtatgagatgcaagatgctggaattacttcagactcaatgatgaagaacttcttctttgtgccttcttgcattcagctgagccaagaagacagcttttccgctgaagcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lactation elevated 1
- plastin 1 (I isoform)
- choline dehydrogenase
- butyrylcholinesterase

Buy AZIN1-antizyme inhibitor 1 Gene now

Add to cart