LRRC56-leucine rich repeat containing 56 Gene View larger

LRRC56-leucine rich repeat containing 56 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRRC56-leucine rich repeat containing 56 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LRRC56-leucine rich repeat containing 56 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035936
Product type: DNA & cDNA
Ncbi symbol: LRRC56
Origin species: Human
Product name: LRRC56-leucine rich repeat containing 56 Gene
Size: 2ug
Accessions: BC035936
Gene id: 115399
Gene description: leucine rich repeat containing 56
Synonyms: leucine-rich repeat-containing protein 56; leucine rich repeat containing 56
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatctgggctgggacagatcccgtgggcctcggcggagcacctccagcgtccgggtgcgggagctgagctggcaaggcctgcacaacccctgcccacagagcaagggccctggcagtcagagggacagacttggagagcagctggtggaagagtacctgtcccctgcccggctgcaggccctggcccgggtggatgaccttcggctggtgaggacgctggagatgtgtgtggacactcgtgagggcagcctggggaactttggggtgcacctgcccaacctggaccaactgaagctgaacggcagccacctgggctccctgagggacttgggcacgtctctgggccacctgcaggtgctgtggctggctcgctgtggcctcgctgacctggatggcatcgcctctttgccagcacttaaggaactctacgcctcctacaacaacatctcggacctgagcccactgtgcctgctggaacaattggaggtgctggacctggagggcaacagcgtggaggacctggggcaggtgcgctacttgcagctgtgcccacgcctggccatgctcaccctggagggcaacctggtgtgcctacagccggcccctggccccaccaacaaggtgcccaggggctacaactacagggcagaggtgaggaagctcattccccagctgcaggtcctggacgaagtgccggccgcacacacaggcccaccggcccccccgcggctgagccaggactggcttgcggtgaaggaggccatcaagaagggcaacggccttcccccgctggactgtccccgtggagcccccatccggagacttgaccccgagctgtccctgcctgagacgcagtcccgggcctccaggccctggcccttctccctgctggtccgtgggggccccctgcctgaaggcctgctttctgaggacctggccccagaagataacccagcagcctcacccatggtgctggccaagtcctctgtgggaaccccaccaagggcctgcgggagcgtaggcaccagtgccaggccagggagccccccgagcagctgccccaacacaggccaggagatccggccgccagcacttccaccccagagcctgaccctgcagacagctctgacttcctggccttggctgggctcagggcctggagggaacatggcgtgcgccccctcccctataggcacccggagtcccaacaggaaggggctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interleukin 13 receptor, alpha 1
- sphingosine-1-phosphate receptor 4
- hexosaminidase B (beta polypeptide)
- ribonuclease/angiogenin inhibitor 1

Buy LRRC56-leucine rich repeat containing 56 Gene now

Add to cart